ID: 1160937955

View in Genome Browser
Species Human (GRCh38)
Location 19:1606186-1606208
Sequence CGGTGTGGGCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160937937_1160937955 10 Left 1160937937 19:1606153-1606175 CCCAGCTTCCAGCCTCCCCCCTG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937947_1160937955 -8 Left 1160937947 19:1606171-1606193 CCCTGCACACCGGGCCGGTGTGG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937946_1160937955 -7 Left 1160937946 19:1606170-1606192 CCCCTGCACACCGGGCCGGTGTG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937949_1160937955 -9 Left 1160937949 19:1606172-1606194 CCTGCACACCGGGCCGGTGTGGG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937936_1160937955 30 Left 1160937936 19:1606133-1606155 CCGTACATGCTCACTCAGCTCCC No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937942_1160937955 -2 Left 1160937942 19:1606165-1606187 CCTCCCCCCTGCACACCGGGCCG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937945_1160937955 -6 Left 1160937945 19:1606169-1606191 CCCCCTGCACACCGGGCCGGTGT No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937939_1160937955 2 Left 1160937939 19:1606161-1606183 CCAGCCTCCCCCCTGCACACCGG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937944_1160937955 -5 Left 1160937944 19:1606168-1606190 CCCCCCTGCACACCGGGCCGGTG No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data
1160937938_1160937955 9 Left 1160937938 19:1606154-1606176 CCAGCTTCCAGCCTCCCCCCTGC No data
Right 1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160937955 Original CRISPR CGGTGTGGGCAGAAGGAAGA GGG Intergenic
No off target data available for this crispr