ID: 1160939141

View in Genome Browser
Species Human (GRCh38)
Location 19:1611993-1612015
Sequence CCTTCCTTGAGAAGGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160939129_1160939141 15 Left 1160939129 19:1611955-1611977 CCATCACGTGTGGCCTCCTGTAT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1160939131_1160939141 2 Left 1160939131 19:1611968-1611990 CCTCCTGTATTTCCGGCTCTCAC 0: 1
1: 0
2: 1
3: 3
4: 107
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1160939132_1160939141 -1 Left 1160939132 19:1611971-1611993 CCTGTATTTCCGGCTCTCACCTC 0: 1
1: 0
2: 1
3: 19
4: 122
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1160939133_1160939141 -10 Left 1160939133 19:1611980-1612002 CCGGCTCTCACCTCCTTCCTTGA 0: 1
1: 0
2: 1
3: 65
4: 735
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1160939127_1160939141 17 Left 1160939127 19:1611953-1611975 CCCCATCACGTGTGGCCTCCTGT 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1160939128_1160939141 16 Left 1160939128 19:1611954-1611976 CCCATCACGTGTGGCCTCCTGTA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG 0: 1
1: 0
2: 1
3: 24
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160939141 Original CRISPR CCTTCCTTGAGAAGGCTGGG GGG Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900641637 1:3690469-3690491 CCTGCCTGGGGAAGGCTCGGGGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903351582 1:22720044-22720066 CCCTCATAGAGAAGGCTGGAAGG + Intronic
903389267 1:22952987-22953009 CCTTACTCTAGAAAGCTGGGAGG + Intergenic
903897911 1:26620839-26620861 CATTCCTGGAGAAGGATGTGTGG + Intergenic
904396754 1:30227524-30227546 CTTTCCTTGGAAAGGCTGGGAGG - Intergenic
905319890 1:37108372-37108394 TCTTTCTTGACAAGGCTGGATGG + Intergenic
905586783 1:39126201-39126223 GATTCCTTGTGAAGGCTGTGAGG + Intronic
905863764 1:41366147-41366169 CCCTGCTGGAGCAGGCTGGGGGG - Intronic
906229863 1:44152873-44152895 TCATCCTGGAGAAGGCAGGGTGG - Intergenic
906778114 1:48548278-48548300 GCTTCCTTGAGAAGGTGGGTGGG + Intronic
907912902 1:58842209-58842231 GGTTCCTTGAGAAGGCTCTGAGG + Intergenic
909942757 1:81630256-81630278 CTTTCCTGGAGAAGGCTGGGAGG - Intronic
915147676 1:153805021-153805043 CCTTCCCTGAATAGGGTGGGTGG - Exonic
915431093 1:155867743-155867765 GCTTTCTATAGAAGGCTGGGAGG + Intronic
915892368 1:159783808-159783830 CCTCACTTGAGTAGGCTAGGTGG - Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916585638 1:166147471-166147493 TCTGCCTGGAGAAGGCTGGATGG + Intronic
916833768 1:168520530-168520552 CCATCCTTTAGTAGGCAGGGGGG + Intergenic
917300359 1:173567746-173567768 CCTTCATTGAAAGGGCTGGAAGG - Intronic
917692833 1:177486736-177486758 CCTTCCTTGTGGAAACTGGGAGG - Intergenic
920915229 1:210253268-210253290 CCTGCTGTGAGAAGGGTGGGTGG - Intergenic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
1062931650 10:1356735-1356757 CTTTGCTTGAGAAGGCTGGAGGG - Intronic
1063207966 10:3853117-3853139 CGTGGCTTGGGAAGGCTGGGTGG + Intergenic
1064164485 10:12974545-12974567 CCTGCCTTCAGAAGGCTGAAAGG - Intronic
1064263990 10:13809676-13809698 TCTTCCTCAAGAAAGCTGGGAGG - Intronic
1067721590 10:48731722-48731744 TCTTCATTGGGAAGACTGGGTGG - Intronic
1068950289 10:62769894-62769916 CCATCCTGGAGAAGACTGGTGGG - Intergenic
1069265656 10:66454151-66454173 CCTTCCTAGAGACTGCAGGGGGG - Intronic
1069908802 10:71747647-71747669 CCTTCCCTGAAAATCCTGGGAGG - Exonic
1072548274 10:96457253-96457275 CTTTCCCTGAGGAGGCAGGGAGG - Intronic
1074669371 10:115771664-115771686 CCTTCCTTGAGAACGCTTTCAGG + Intronic
1074942525 10:118249034-118249056 CCATCCTTGAGAAGATGGGGAGG - Intergenic
1075200708 10:120401481-120401503 CCTTCATTCATAAGGATGGGAGG - Intergenic
1075337725 10:121620578-121620600 AATTCCTTGAGCAAGCTGGGAGG + Intergenic
1076224238 10:128760911-128760933 CACTCCATGAGAAGGCTGGCTGG + Intergenic
1078642363 11:13108577-13108599 CCTGGCTGGAGAAAGCTGGGTGG + Intergenic
1079027561 11:16961012-16961034 CCTTCCTTGAGTGGGGTGGAGGG - Intronic
1079362660 11:19782169-19782191 CTTTCCTTGAGAAAGCAGGTTGG + Intronic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1080583997 11:33665674-33665696 CCTACCTTCAGAAGGCCAGGGGG - Intronic
1085635894 11:78159332-78159354 ACTTCTTTGAGAATGCTGGTGGG + Intergenic
1088511454 11:110579891-110579913 CCTTCTTTGTATAGGCTGGGCGG + Exonic
1089188734 11:116638664-116638686 CCTGTCTTGAGAAGGCAGGCAGG + Intergenic
1089556289 11:119317330-119317352 CCTGGCTTGGGAAGGCTGAGGGG + Intronic
1089906973 11:122049966-122049988 CCTTCCTTTAAAAGGCTGAATGG + Intergenic
1091407683 12:219504-219526 CCTTCCTGGAGAATGCTGCTCGG - Intergenic
1091787498 12:3251952-3251974 CCCACCATGAGAAGTCTGGGTGG - Intronic
1092128802 12:6093976-6093998 CCAACCCTGACAAGGCTGGGAGG - Intronic
1092169414 12:6363809-6363831 CCATCCCGGAGAAGCCTGGGCGG + Intronic
1096162321 12:49389182-49389204 CTTTGCGTGAGAAGGCTGGGCGG - Intronic
1096260410 12:50086463-50086485 TCATCCTTGAGAATGCTTGGTGG + Intronic
1096670220 12:53194048-53194070 CCTTCCTGGAGCAGTCTGAGTGG - Exonic
1102233117 12:111277226-111277248 CCCTCCCTGCGCAGGCTGGGAGG - Intronic
1103763175 12:123265718-123265740 GCTTCCTGGAGACGACTGGGTGG - Intronic
1106899995 13:34345484-34345506 CCTTCTGTGAGATGGCTGAGGGG + Intergenic
1108684191 13:52804663-52804685 TCTGCCCTGGGAAGGCTGGGAGG - Intergenic
1109876333 13:68408627-68408649 CCTTCCTTAACAATGCTTGGAGG + Intergenic
1112785939 13:102952013-102952035 CCTTCCTTGACACTGCTGTGTGG - Intergenic
1114550513 14:23530189-23530211 CCTTCCCTGTGTAGGATGGGGGG + Exonic
1115037859 14:28882611-28882633 CCTTCCTTGAGAATGCCAGAAGG + Intergenic
1115741916 14:36397850-36397872 CCATCCATGGGATGGCTGGGTGG - Intergenic
1119783113 14:77291653-77291675 CCTCCCTCTAGAAGGCTGGATGG - Intronic
1120127118 14:80757929-80757951 ATTTCCTTGAAAAGGCAGGGAGG - Intronic
1120382110 14:83793645-83793667 GCTTCCTTCAGAAGGCTGTTGGG + Intergenic
1121051309 14:90820583-90820605 CCTTCCTTCTGAAGGCAGTGAGG + Intergenic
1121957083 14:98223942-98223964 ACTTCCTGGAGAAGGAAGGGAGG + Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1123912059 15:24977761-24977783 CATTACCTGAGAAGGCAGGGCGG - Exonic
1124594716 15:31083015-31083037 GATACCTTGAGAAGGCTGGACGG + Intronic
1125217142 15:37288081-37288103 CTTTCCTTGACAAGGCTTGTTGG + Intergenic
1125242072 15:37587170-37587192 CCCTCCTAGAGAAGGATGTGGGG - Intergenic
1125636111 15:41189885-41189907 CCTTCCTTGAGAAGGCAGAAAGG + Intronic
1128508854 15:68301370-68301392 CCGGCCTGGAGAAGTCTGGGAGG + Intronic
1129453574 15:75664126-75664148 GCTGCCTTTTGAAGGCTGGGGGG + Intergenic
1130577230 15:85103493-85103515 CTTCACTTGAGAAGGCAGGGTGG + Intronic
1132699003 16:1214316-1214338 CCTTCTTCTAAAAGGCTGGGAGG - Intronic
1134177913 16:12023372-12023394 ACTTTGTTGAGAGGGCTGGGGGG - Intronic
1134342839 16:13360817-13360839 TATTCCCTGAGAAGGCCGGGAGG - Intergenic
1136294960 16:29296264-29296286 ACGTCCTTGGGAAGGATGGGTGG - Intergenic
1137728413 16:50672459-50672481 CCATCCTTTTGAAGGGTGGGAGG - Exonic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1142100854 16:88270273-88270295 ACGTCCTTGGGAAGGATGGGTGG - Intergenic
1142864994 17:2785297-2785319 CCTTCCTTAACAGGGCTGGAAGG - Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG + Intronic
1143405706 17:6675870-6675892 CCTCCCTTGAGAAGTCTAGCCGG - Intergenic
1143652222 17:8270449-8270471 CCTTTATTGAAAAGGCGGGGAGG - Exonic
1144482370 17:15638684-15638706 CCTTCCTTGCCAGGGATGGGAGG - Intronic
1144916313 17:18726348-18726370 CCTTCCTTGCCAGGGATGGGAGG + Intronic
1145252202 17:21302805-21302827 TTTCCCTTGGGAAGGCTGGGTGG - Intronic
1146004804 17:29154552-29154574 CCCTGCCTGAGAAGCCTGGGGGG - Intronic
1148123046 17:45223442-45223464 TCTCCCAAGAGAAGGCTGGGGGG + Intronic
1148872165 17:50664829-50664851 CCTTCCTGCAGAAGCCAGGGAGG + Intronic
1149751778 17:59153620-59153642 TCTTCCTTGGAAAGGATGGGTGG - Intronic
1150306680 17:64091581-64091603 CCCTGCTTGAGAAGCCAGGGAGG + Intronic
1150984949 17:70185412-70185434 CCTCCCTGGAAAAGGCAGGGAGG - Intergenic
1151432008 17:74070049-74070071 CTTCCCTTGAGCAGGTTGGGTGG - Intergenic
1151579313 17:74969159-74969181 GCTTCCTTGGGCGGGCTGGGTGG - Intronic
1152605441 17:81287298-81287320 CTTTCCCTGGGACGGCTGGGTGG - Intronic
1156111981 18:33739272-33739294 CCCTCCTGGAGAAGGCAGGCTGG - Exonic
1156447434 18:37248110-37248132 CCATCCTAGAGAAGGCTGCAAGG + Intronic
1159580023 18:70224904-70224926 CTGTCCTTGGGAAGGCTTGGAGG - Intergenic
1159878188 18:73833354-73833376 CCTTGCTTGAGAAGGCTCTTTGG - Intergenic
1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG + Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161253489 19:3293745-3293767 CCTTCCCGGAGAAGGCTTTGAGG + Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1162080717 19:8216042-8216064 CCCTCCCTGAGAAGGTAGGGAGG - Intronic
1164147583 19:22521443-22521465 CCTGTCTTGGGCAGGCTGGGGGG + Intronic
1165318078 19:35068771-35068793 CCTGCCCTGGGAAGTCTGGGGGG + Intergenic
1165490226 19:36119115-36119137 CCTTCCTTGAGTGGCCTGGGAGG - Intronic
1165718626 19:38063289-38063311 CCTGCCGTGGGAAGGCTGGCAGG - Intronic
1167037996 19:47005499-47005521 CCTCCCTTGAGAAGGGTCTGAGG - Intergenic
1167429885 19:49448089-49448111 GCTTCCTGCAGAGGGCTGGGGGG - Intronic
925579415 2:5395424-5395446 CCTGCCTTAAGATGGCTGGCTGG - Intergenic
925590865 2:5507880-5507902 CCTTCCATGAGATGCCCGGGGGG + Intergenic
925590874 2:5507907-5507929 CCTTCCATGAGATGCCCGGGGGG + Intergenic
925590890 2:5507962-5507984 CCTTCCATGAGATGCCCGGGGGG + Intergenic
925917713 2:8618766-8618788 GGTTCCTTCAGAAGGCTGGGAGG + Intergenic
926213432 2:10888617-10888639 CCTGCCTTGAGAGGTTTGGGTGG + Intergenic
926358738 2:12065402-12065424 CCTCCCTGGAGAAGGCAGGGAGG + Intergenic
926420499 2:12692072-12692094 TCTTCCTTGAGAAGGTTTAGAGG - Intergenic
930900210 2:56497105-56497127 ACCTACTTGAGAATGCTGGGTGG - Intergenic
934560530 2:95310884-95310906 CCTTCCGTGAGAAGCCAGGCTGG + Intronic
935001791 2:99024881-99024903 CATCCATTGAGAAGGCTGTGTGG + Intronic
936327442 2:111517951-111517973 CCTGTCTTGAGAGAGCTGGGGGG - Intergenic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
938881587 2:135594978-135595000 CCTTCATTGAAAAGGGGGGGGGG - Intronic
938900873 2:135797607-135797629 CCTTCCTTGACAAGAAGGGGCGG + Intronic
941517483 2:166497234-166497256 CCTTCTTTGTAAAGGCTGTGTGG - Intergenic
943626737 2:190209718-190209740 CCATCCTTGAGAAGGCAAGAGGG - Intronic
945573726 2:211503762-211503784 CTTTCCCTGAGAAGGCTCTGTGG + Intronic
946302295 2:218831350-218831372 CCTTCCTGGAGCAGCCTTGGGGG - Exonic
946308249 2:218868337-218868359 CCTCCCTTAAGAAGGCAGGAGGG - Intronic
946392197 2:219423317-219423339 CATTCCTTGAGCAGTATGGGTGG + Intronic
948673685 2:239584634-239584656 CCCTCCATGAGATGCCTGGGCGG - Exonic
1169145804 20:3251665-3251687 CCTTCCTTGGCAAGGCTTGTGGG + Exonic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1172950484 20:38720249-38720271 CCTTGCTTCACAAGGCTTGGTGG + Intergenic
1173294732 20:41747028-41747050 CCTTCCTTGATGAGGGTGGCTGG + Intergenic
1173655664 20:44698715-44698737 CCTTCCATGTCCAGGCTGGGAGG + Intergenic
1173861388 20:46286055-46286077 CCTTCCTGGAGAGGGCTGGCAGG + Intronic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1178671044 21:34591990-34592012 CATGCCTTAAGAAAGCTGGGGGG + Intronic
1179269899 21:39842643-39842665 CCTTCCTAGAGAGGGATAGGTGG + Intergenic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1180027800 21:45178272-45178294 CCTGGCTTGGGAAGGCTGGAGGG + Intronic
1183200142 22:36380265-36380287 CCATCCTTGAGAAGGGGGGTAGG + Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183974051 22:41500133-41500155 CCTGCCCTGAAAAGGTTGGGAGG - Intronic
1184080363 22:42214976-42214998 CCTTCGCTGAGGAGGCTGTGGGG + Exonic
954574475 3:51668193-51668215 CCTGTCTTGGGCAGGCTGGGGGG - Exonic
955983678 3:64551561-64551583 CCTTCCTTTAGACAGCTGGGTGG - Intronic
956876742 3:73471303-73471325 CGTTCCTTGTGAAACCTGGGGGG - Intronic
956938067 3:74126491-74126513 CCCTCCTTGAAATCGCTGGGTGG + Intergenic
960322807 3:116257276-116257298 CCATCCCTCAGAAGGCTGGGAGG + Intronic
960906125 3:122603333-122603355 TCTTCCTTGAGTAAGCTGGGTGG - Intronic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
966382328 3:179356240-179356262 CCTTCCTGGAAATGGGTGGGTGG - Intronic
971998811 4:34001834-34001856 GCTCACTTAAGAAGGCTGGGGGG - Intergenic
974794177 4:66727607-66727629 CACTCCTAGAGAAGGGTGGGGGG - Intergenic
977504140 4:97880108-97880130 CCTTCTTTTAGAAGGCTGTACGG - Intronic
978656658 4:111073645-111073667 GCTTACTTGAGAATGGTGGGTGG + Intergenic
981931463 4:150193551-150193573 CCTTCCTTCAGAATGGTGGTTGG + Intronic
984793440 4:183635397-183635419 GATTCCTTGACAAGGGTGGGAGG - Intergenic
990447076 5:55903360-55903382 CCTTCCTTGAAGAAGCAGGGAGG - Intronic
991507234 5:67337993-67338015 CATTCCTTGAGAGGACTGAGTGG + Intergenic
992772439 5:80060863-80060885 CCTTCCTTGGGCTGGGTGGGAGG - Intronic
993525384 5:88959440-88959462 CATTCATTAAAAAGGCTGGGGGG + Intergenic
993898749 5:93570662-93570684 CACTCCTTGAGAAGGCCGGAGGG - Intergenic
993945406 5:94111828-94111850 CCTTCCTTGTGAAGGCTGCCTGG + Intergenic
995250846 5:109991818-109991840 GGTTCCTTGTGAGGGCTGGGAGG + Intergenic
995610940 5:113909641-113909663 CCTGTCTTGAGAAGACAGGGTGG - Intergenic
997571605 5:134932583-134932605 CCCTGCCTGAGAAGGCAGGGGGG - Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
1000996457 5:167964076-167964098 CCTTCTGTGAATAGGCTGGGAGG - Intronic
1002796191 6:472803-472825 CCTTGCTTGAGAAGAGTGGCAGG + Intergenic
1002870754 6:1165629-1165651 CCTGGCTCAAGAAGGCTGGGAGG - Intergenic
1003458895 6:6310913-6310935 GCTTCCCTGGGAAGGCTGGAAGG - Intronic
1003643196 6:7892898-7892920 CCTTCTTGGAGAAGGGAGGGCGG + Intronic
1004605036 6:17186095-17186117 CTTTCCTTAAAAAGGGTGGGGGG - Intergenic
1005182146 6:23118020-23118042 GGTTCCTTGGGAAGGCTGGCTGG + Intergenic
1005273571 6:24192084-24192106 CCTCCCTTGAGAAATATGGGAGG + Intronic
1006749274 6:36366496-36366518 CATTGCTTGGGAAGGCTGGGAGG - Exonic
1006942750 6:37763699-37763721 CCCACCAAGAGAAGGCTGGGGGG - Intergenic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1007738977 6:43999778-43999800 TCTTCCTGGGGAAGGATGGGAGG - Intergenic
1011208092 6:84923236-84923258 CTTTGCTTGTGAAGGCTGGGAGG - Intergenic
1015104132 6:129516636-129516658 CTTTCCTTGAGATGACTGGAGGG - Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1016708173 6:147138133-147138155 GCTTCCTTCTGAGGGCTGGGAGG - Intergenic
1018454478 6:163939790-163939812 CCACCCTTGAGGAGCCTGGGTGG - Intergenic
1018730217 6:166644532-166644554 CCTTCCCTGAGAATACCGGGAGG - Intronic
1019701089 7:2475385-2475407 CCTTCCTGGAGACGGCCGGCAGG - Intronic
1022239102 7:28491474-28491496 ATTTCCTTGAGAAGGCTGAATGG + Intronic
1024081808 7:45862662-45862684 TCTTTCCTGAGAAGGCTGAGTGG + Intergenic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027506917 7:79027362-79027384 CCTTCTTTCTAAAGGCTGGGTGG - Intronic
1029412390 7:100422946-100422968 CTTTTCTTCAGAAAGCTGGGTGG - Intronic
1029589701 7:101499205-101499227 CCCACCTTGTGATGGCTGGGAGG - Intronic
1031052347 7:116956520-116956542 GCTTCCTTGAGGAGGAAGGGAGG - Exonic
1032195235 7:129784884-129784906 TCTTTCTGGAGAAGGCTGGGAGG + Intergenic
1035049307 7:155989517-155989539 CCTTCCCTGGGAAGGCTGCAGGG + Intergenic
1035754704 8:2022664-2022686 CCTTCCTTGAGAAAGAGTGGAGG + Intergenic
1036084385 8:5597976-5597998 CCTTCCTTGAAAATGCTTCGTGG - Intergenic
1036194332 8:6700802-6700824 GGTTCTTTGTGAAGGCTGGGAGG + Intergenic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1037176416 8:15951733-15951755 CCTGCCTTGAGAATGGTGAGGGG - Intergenic
1039885672 8:41652879-41652901 CCTTCCTAGGGAATGCTGGGGGG + Intergenic
1043376178 8:79652297-79652319 TCTTCCTTGAGAAGGTTTGCTGG + Intronic
1044769643 8:95617809-95617831 CTTTGCTTGTGAAGGCTGGGCGG - Intergenic
1044785955 8:95793018-95793040 CCATCTCTGAGAAGGCTGGTGGG - Intergenic
1046615386 8:116471924-116471946 CCTTCCTTGTGAAGACTGATTGG - Intergenic
1047526509 8:125638561-125638583 CCTCCCTTGAGTAGCCTTGGTGG + Intergenic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049478644 8:142809537-142809559 GCTTCCTGGAGAAGGCCAGGTGG + Intergenic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1049814207 8:144590660-144590682 CCAGCCTGCAGAAGGCTGGGGGG + Intronic
1050297096 9:4216569-4216591 CCTTCCTTCAGAACCCTGGCTGG - Intronic
1051724302 9:20072818-20072840 GCTTCCTTCTGAAGGCTGTGAGG - Intergenic
1051883518 9:21865065-21865087 CCCTCCTTGATAAGGTTTGGCGG + Exonic
1052796351 9:32927056-32927078 CCTTCCCTGAAAAAGCTGGCAGG + Intergenic
1053428389 9:38026044-38026066 CCTTCCTTGGGAAGGGGGTGGGG - Intronic
1059408664 9:114118319-114118341 CCTTCCTGCATAAGGCTTGGCGG + Intergenic
1059438182 9:114288859-114288881 CCATCCTGCAGAGGGCTGGGAGG - Intronic
1059518351 9:114916512-114916534 TCTTCCTTGGAAAGTCTGGGTGG + Intronic
1060785547 9:126449295-126449317 CCTCTGTTGAGAAGGCTCGGTGG + Intronic
1061393716 9:130331985-130332007 CCTTCCAGGAGAAGGGTGGGTGG - Intronic
1062079997 9:134618752-134618774 GCTTCCTAGAGAAGGGTGTGGGG + Intergenic
1187440290 X:19311912-19311934 CCTGCCCTGAAAAGGGTGGGAGG - Intergenic
1192360509 X:70435812-70435834 CCATCCTTATGAAGGCTGTGGGG - Intergenic
1195802703 X:108731784-108731806 CCCTCTTTTAGAAGGGTGGGGGG + Intronic
1197346040 X:125326665-125326687 TCTTCCAGGAGAAAGCTGGGGGG - Intergenic
1200908885 Y:8513865-8513887 CTGTCCTGGAGAAGGCCGGGGGG + Intergenic
1201553523 Y:15244177-15244199 TCTTCCTCGCTAAGGCTGGGTGG - Intergenic
1202195890 Y:22298000-22298022 CCGTCCCGGAGAAGGCCGGGGGG - Intergenic