ID: 1160942006

View in Genome Browser
Species Human (GRCh38)
Location 19:1624652-1624674
Sequence GAGTGCTGGTTTCCGGGTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160942006_1160942015 17 Left 1160942006 19:1624652-1624674 CCGTAACCCGGAAACCAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1160942006_1160942011 1 Left 1160942006 19:1624652-1624674 CCGTAACCCGGAAACCAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1160942011 19:1624676-1624698 GGCGCCTTCCTGATCACTCACGG 0: 1
1: 0
2: 0
3: 6
4: 88
1160942006_1160942014 16 Left 1160942006 19:1624652-1624674 CCGTAACCCGGAAACCAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1160942014 19:1624691-1624713 ACTCACGGACGTGCGCACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160942006 Original CRISPR GAGTGCTGGTTTCCGGGTTA CGG (reversed) Intronic
900624334 1:3601188-3601210 GAGTGCTGGTGGCCGGGCTGAGG - Intronic
900718713 1:4161405-4161427 GGGTGCTGTTGTCCGGGTTCCGG + Intergenic
912378982 1:109236429-109236451 GAGGCCTGGTTTCCGGGCTCAGG + Exonic
924041681 1:239990016-239990038 AGGTGCTGCTTTCTGGGTTAAGG + Intergenic
1063169635 10:3496113-3496135 GAGTGGTTATTTCTGGGTTATGG - Intergenic
1063370820 10:5521891-5521913 AACTGCTGGTTTCTGGGTCATGG - Intergenic
1067993193 10:51239220-51239242 TACTTCTGGTTTCTGGGTTACGG - Intronic
1072167262 10:92826076-92826098 GAATGCTGGTTGCCGGGGTGAGG - Intergenic
1087721867 11:101674822-101674844 GAGTGCTGTTTTGGGGGTTGGGG + Intronic
1088742511 11:112778576-112778598 GATTGCTGGTTTCTGGGCTGTGG - Intergenic
1090953369 11:131493788-131493810 TAGTACTGGTTTCTGGGTAAAGG - Intronic
1097533405 12:60834948-60834970 GAATACTGCTTTCCGGGGTAAGG + Intergenic
1098687697 12:73445791-73445813 AAGTGATGGTTTCCTGTTTAAGG + Intergenic
1105839368 13:24240441-24240463 GAGTGTTGGTTTTGGGGTCACGG + Intronic
1108082545 13:46751829-46751851 AAGTGCTGGTTTCCTGATTCAGG - Intronic
1110116404 13:71821788-71821810 GATTGCTGGTTTCAGTTTTAAGG - Intronic
1114897815 14:27013707-27013729 GAGTGCTGGTGTACTGGTCAGGG + Intergenic
1117133614 14:52710596-52710618 GAGTGATGGTTGCTGGGTTTTGG + Intronic
1118315942 14:64726200-64726222 GGGTGTTGGTTTCCAGGTTGAGG + Intronic
1124795734 15:32776328-32776350 GACTGCTGGTTTCCAGCATAGGG + Intronic
1125766592 15:42140664-42140686 TAGTTCTGGTTTCCAGGTTGGGG - Exonic
1132911379 16:2314437-2314459 GGGTGCTGGTTTCCAGGGAAGGG + Intronic
1135200143 16:20430284-20430306 GAGGGCTGGTTTGCTGGTCATGG - Intronic
1135218542 16:20593311-20593333 GAGGGCTGGTTTGCTGGTCATGG + Intergenic
1140070548 16:71645643-71645665 GAGTGCTGTTTTCCAGGAGATGG - Exonic
1141183415 16:81770206-81770228 GGGTGCTGGTTTCTCGGTTGGGG - Intronic
1142256261 16:89015214-89015236 GAGAGCTGGTTCCCGAGCTAAGG + Intergenic
1143030791 17:3965796-3965818 GAATGCTGGTTTTCTGGTTGTGG + Intergenic
1145186563 17:20799562-20799584 GACTGCTGGTGTCTGGGTTCAGG + Intergenic
1148741350 17:49894850-49894872 GAGTGTTGGTTTCTAGGTAAAGG + Intergenic
1148978524 17:51550456-51550478 GACTGCTGGTTTCCCATTTAGGG + Intergenic
1150209462 17:63434249-63434271 GAGTGCTGCTTTCTGGGGTCAGG - Exonic
1151518016 17:74609296-74609318 CAATGCTGGTTTCCTGGTTTGGG + Intergenic
1160942006 19:1624652-1624674 GAGTGCTGGTTTCCGGGTTACGG - Intronic
1161605693 19:5213604-5213626 GTGTGCTTGTGTCCAGGTTAGGG + Intronic
1163421897 19:17218310-17218332 GAGTGTTGGTTTCCCGTTTCCGG - Intronic
1167294131 19:48639564-48639586 GAGTGATGGTGTCGCGGTTAAGG + Exonic
1167668023 19:50833918-50833940 GAGTTCTGGATCCCGGGTTCTGG + Intronic
925348486 2:3186203-3186225 AAGTGTTGGTTTCCGGGAGAAGG - Intergenic
930705083 2:54497116-54497138 GTGTGCTGGTTTCCTGGTGGGGG - Intronic
931023445 2:58078163-58078185 GAATGCTGGTTTCCAGGTGCTGG - Intronic
933780963 2:85800902-85800924 GAAGGCTGGTTTGGGGGTTAAGG - Intergenic
945317359 2:208384191-208384213 TAGAGCAGGTTTCCGGGTGAAGG + Intronic
946450514 2:219775120-219775142 GAGTGCTGGTTGCGGGGCTGGGG - Intergenic
1172633894 20:36396304-36396326 GTGTGCTGGGTTCTGGGTGAGGG - Intronic
1177824445 21:26066518-26066540 GAATGGTGGTTTCCAGGTTCTGG - Intronic
1183138985 22:35918114-35918136 GAGTTCTTGTTTCAGTGTTAGGG + Intronic
1184625223 22:45722099-45722121 GAGTGATGATTTCTGGGTTAAGG + Intronic
949443163 3:4105204-4105226 GAATGCTGGTTTCCAGGGTCTGG + Intronic
951991773 3:28683307-28683329 GAGTGGTGGGGTCTGGGTTATGG + Intergenic
953930400 3:47003044-47003066 GAGCGCTGGCTTCCAGGTGAGGG - Exonic
955713635 3:61805599-61805621 GAGGACTGTTTTCTGGGTTAGGG + Intronic
961061230 3:123830989-123831011 GAGTGCAGGTGACCAGGTTATGG + Intronic
962676155 3:137760263-137760285 CAGTGCTTGCTTCTGGGTTATGG + Intergenic
969246034 4:5933577-5933599 GAGTGCTGGTGTCAGGGACATGG - Intronic
977627620 4:99204457-99204479 GAATGCCAGTTTCTGGGTTATGG + Intronic
978810143 4:112840506-112840528 GAGTGCTGGATGCGGGGATAAGG + Intronic
979327590 4:119397670-119397692 GAGTGCTGCCTCCCGGGTTCAGG + Intergenic
982283878 4:153714804-153714826 GAATGCTGGTTTCCAGGCTCAGG + Intronic
985918404 5:2946147-2946169 CAGTGCTGGTCTCCAGGTGACGG + Intergenic
989660276 5:43790721-43790743 GAGGGCTGGTGTCTGGGATAAGG - Intergenic
999173963 5:149618537-149618559 GAGAGCTGGTCTCTGGGTTTGGG + Intronic
1013477481 6:110522243-110522265 GAGTCCTGGTTTCCAGGGAAAGG - Intergenic
1026403888 7:70044182-70044204 GTGTGCTGGTTTCCAGGTGCAGG + Intronic
1027925715 7:84460631-84460653 AATTGCTGGTTTCCAGGTTATGG - Intronic
1031592771 7:123613641-123613663 GAGGGCTGGTTTCCGGTCTATGG + Intronic
1038179604 8:25214177-25214199 GAGTTCAGGTTTCTGGATTAGGG + Intronic
1039968366 8:42299941-42299963 GAGGGCTGACTTCCGGGTTTGGG + Intronic
1053707455 9:40769102-40769124 GAGTGCTGGTTTGCAGGCTCTGG + Intergenic
1053913311 9:42926745-42926767 GAGTGCTGGTTTCCAAGAAAAGG - Intergenic
1054417367 9:64889870-64889892 GAGTGCTGGTTTGCAGGCTCTGG + Intergenic
1059663265 9:116422358-116422380 GAGTACTGATTTCCAGGTTTGGG - Intergenic
1059682137 9:116596254-116596276 GAGTGATGGTTTCCAGGTGCTGG + Intronic
1060009952 9:120034886-120034908 GAGTGATGGTTTCCAGGGTCTGG - Intergenic
1060967518 9:127720225-127720247 GAGTGCTCGTTTCCCGGGTGGGG - Intronic
1061796882 9:133090809-133090831 GAGTGCTGATTGCCAGGATAAGG - Intergenic
1062421294 9:136483859-136483881 GCGCGCTGGTTGCCTGGTTACGG + Exonic
1190330489 X:49232220-49232242 GAGTGGTGGGTTTTGGGTTAGGG + Intronic
1190380943 X:49839343-49839365 GAGTTCTGGTTTCCACCTTAGGG + Intergenic
1192632412 X:72787759-72787781 GACTGCTGTTTTCCAAGTTATGG + Intronic
1192649297 X:72933042-72933064 GACTGCTGTTTTCCAAGTTATGG - Intronic
1201790861 Y:17839285-17839307 GAGTTCAGGGTTCTGGGTTAGGG + Intergenic
1201810693 Y:18066704-18066726 GAGTTCAGGGTTCTGGGTTAGGG - Intergenic
1201937575 Y:19424646-19424668 GAGGGCTGGTGTCTGGGTTGAGG - Intergenic
1202276004 Y:23119941-23119963 CAGTGCTGGGTTCCAGGTTTAGG - Intergenic
1202290024 Y:23300750-23300772 CAGTGCTGGGTTCCAGGTTTAGG + Intergenic
1202352480 Y:24008939-24008961 GAGTTCAGGGTTCTGGGTTAGGG + Intergenic
1202428997 Y:24753660-24753682 CAGTGCTGGGTTCCAGGTTTAGG - Intergenic
1202441794 Y:24916429-24916451 CAGTGCTGGGTTCCAGGTTTAGG + Intergenic
1202518299 Y:25661176-25661198 GAGTTCAGGGTTCTGGGTTAGGG - Intergenic