ID: 1160942008

View in Genome Browser
Species Human (GRCh38)
Location 19:1624658-1624680
Sequence GCGCCTGAGTGCTGGTTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160942008_1160942014 10 Left 1160942008 19:1624658-1624680 CCCGGAAACCAGCACTCAGGCGC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1160942014 19:1624691-1624713 ACTCACGGACGTGCGCACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 47
1160942008_1160942016 25 Left 1160942008 19:1624658-1624680 CCCGGAAACCAGCACTCAGGCGC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1160942016 19:1624706-1624728 CACAGTGGGAAAAGTTCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 98
1160942008_1160942011 -5 Left 1160942008 19:1624658-1624680 CCCGGAAACCAGCACTCAGGCGC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1160942011 19:1624676-1624698 GGCGCCTTCCTGATCACTCACGG 0: 1
1: 0
2: 0
3: 6
4: 88
1160942008_1160942015 11 Left 1160942008 19:1624658-1624680 CCCGGAAACCAGCACTCAGGCGC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160942008 Original CRISPR GCGCCTGAGTGCTGGTTTCC GGG (reversed) Intronic
900243545 1:1627697-1627719 GCTCCTGAGTGCTGGGTGCCGGG + Exonic
900408852 1:2503968-2503990 GCTCCTCAGCGATGGTTTCCAGG - Exonic
900658575 1:3772200-3772222 GGGCCTGAATGCTGGGTTCGGGG - Intergenic
900854376 1:5169220-5169242 GGGTCTGAGTGCTGGAATCCTGG - Intergenic
902820300 1:18939210-18939232 GCTCCTGCCTGCTGGTTCCCTGG - Intronic
904243353 1:29166460-29166482 GGGCCTGAACGCTGGTTCCCTGG - Intronic
904675206 1:32195012-32195034 GGACCTGAGTGCTGGTGGCCAGG + Exonic
915013542 1:152712472-152712494 GCCCACTAGTGCTGGTTTCCTGG - Intergenic
915146915 1:153800805-153800827 GCTCCTGACTGCTGATGTCCTGG + Intergenic
924602916 1:245507258-245507280 CCACCTGAGTGTTGGCTTCCAGG - Intronic
1062849771 10:735380-735402 GGGTCTGGGTGCTGGTATCCTGG - Intergenic
1070408721 10:76119709-76119731 GTTCCAGAGTGCTGCTTTCCTGG - Intronic
1070798432 10:79230683-79230705 GCTTCAGAGTGCTGGCTTCCCGG - Intronic
1075682732 10:124343999-124344021 GCTCCTGAGTCCAGGTTCCCTGG + Intergenic
1077431140 11:2516592-2516614 GCACCTGTGTGTTGGTTTCAGGG - Intronic
1079136044 11:17776574-17776596 GCGTCTCAGAGATGGTTTCCAGG - Intronic
1081575064 11:44314020-44314042 GGGCCTGACTGCTGCTCTCCAGG + Intergenic
1082686019 11:56240927-56240949 GTGCCTCAGTGCTGTCTTCCTGG - Intergenic
1085322230 11:75582413-75582435 GCGCCTGCGGGCTGGGTTGCAGG + Intergenic
1086226088 11:84511702-84511724 GCTCCTGAGTGCTGGATAACTGG + Intronic
1087619222 11:100523202-100523224 GCACCTGACTGCTGGACTCCTGG - Intergenic
1087626666 11:100603769-100603791 GGGACAGAGTGCTGGGTTCCAGG + Intergenic
1090944903 11:131421038-131421060 GGGCCTGCGTGCTGGACTCCAGG - Intronic
1092007954 12:5085530-5085552 GAGCCTGAGTGATGGTCTCTGGG - Intergenic
1094270121 12:28604799-28604821 GCTCATGAATGCTGGATTCCTGG + Intergenic
1108593356 13:51929856-51929878 GCTGCTGAGTGCTGGGTGCCTGG - Intergenic
1110734679 13:78922477-78922499 GCACCTGGATGCTGATTTCCAGG + Intergenic
1113388505 13:109873465-109873487 CAGCCTGACTCCTGGTTTCCTGG + Intergenic
1113761416 13:112849963-112849985 GTGCCTGAGTCCTGTTCTCCAGG - Intronic
1113854029 13:113434375-113434397 ACGCCTGGGTGCTGGGTCCCAGG - Intronic
1113854039 13:113434417-113434439 ACGCCTGGGTGCTGGGTCCCAGG - Intronic
1113854122 13:113434753-113434775 ACGCCTGGGTGCTGGGTCCCAGG - Intronic
1113854453 13:113436013-113436035 GTGCCTGGGTGCTGGGTCCCGGG - Intronic
1113854484 13:113436139-113436161 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854588 13:113436517-113436539 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854679 13:113436811-113436833 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854795 13:113437273-113437295 GCGCCTGGGTGCTGGGTCCCGGG - Intronic
1113854816 13:113437357-113437379 GCGCCTGGGTGCTGGGTCCTGGG - Intronic
1113854829 13:113437399-113437421 GCACCTGGGTGCTGGGTCCCGGG - Intronic
1115850072 14:37584010-37584032 GCGCCTGTGTGCGGGTCCCCAGG + Intergenic
1117051633 14:51866205-51866227 ACCTCTGAGTGCTGGGTTCCTGG - Intronic
1122427746 14:101621494-101621516 GAGCCTGAGTGCTGATTCCCGGG + Intergenic
1124254774 15:28131612-28131634 GCGCCTGAGTCCTGCAGTCCTGG - Intronic
1124603325 15:31152146-31152168 GGGCCTGAGTGATGGGTTCAAGG - Intronic
1126687085 15:51257636-51257658 GCGCCTGAGCCCAGGTCTCCAGG + Intronic
1128752286 15:70158275-70158297 GCGCCTAAGAGTTGGATTCCAGG - Intergenic
1132878438 16:2150400-2150422 GAGCCTGAGCGAGGGTTTCCAGG + Intronic
1133235223 16:4384528-4384550 GAGCCTGAGTGCTGGGGGCCGGG - Intronic
1136361649 16:29784368-29784390 ACACCTGAGTGGTGGTTGCCAGG - Intergenic
1140481434 16:75264974-75264996 GCACCTGAGGCCTGGTTACCCGG + Intronic
1141068947 16:80935963-80935985 GCGCCCCAGGGCTGGCTTCCTGG + Intergenic
1141776041 16:86122982-86123004 CCACCTGTGTGCCGGTTTCCTGG + Intergenic
1142406385 16:89892519-89892541 GGGCCTGAGTGCTGGAGGCCTGG + Intronic
1142683520 17:1563456-1563478 CCGCCTGAGTGCTGCATTACAGG - Intergenic
1148321734 17:46760136-46760158 GCGCCTGAGTCCTAGTTACTTGG + Intergenic
1148559171 17:48596294-48596316 GCGCCGGAGAGCAGGTCTCCTGG + Exonic
1148560681 17:48604229-48604251 GCGACTTAGAGCTGGTCTCCTGG + Intronic
1149232093 17:54546192-54546214 GAGCCAGAATGGTGGTTTCCAGG + Intergenic
1151212410 17:72554546-72554568 GCACCTGCGTCCTGGTTTCAAGG - Intergenic
1154031767 18:10759439-10759461 GCCACAGAGTGCTGGTATCCGGG - Intronic
1154161249 18:11981911-11981933 GAGCCTTTGTGCTGGTGTCCTGG + Intronic
1160021503 18:75185255-75185277 GTCCCTGAGGGCTGGTTTCCAGG + Intergenic
1160041267 18:75347811-75347833 GTGGCTTAGTGCTGTTTTCCAGG - Intergenic
1160942008 19:1624658-1624680 GCGCCTGAGTGCTGGTTTCCGGG - Intronic
1164796740 19:31039776-31039798 GCTCCTGAGGGCAGGTCTCCTGG + Intergenic
1168531282 19:57131610-57131632 GCGCCTGAGTTCTGGGATCTAGG - Exonic
926353734 2:12021014-12021036 TGGCCTGACTGATGGTTTCCTGG - Intergenic
927494658 2:23544326-23544348 GTGCCTGAGAGCAGGTCTCCGGG + Intronic
929585610 2:43112336-43112358 ACGCCTGCCTGCTGGTTTCCTGG - Intergenic
934113462 2:88764140-88764162 GGGGCTGAGGGGTGGTTTCCTGG - Intergenic
937668697 2:124516165-124516187 GAGCCTGAGTTATGTTTTCCTGG - Intronic
937925547 2:127165063-127165085 GCTCCTGAGTGCTGGGCTCGGGG + Intergenic
944540120 2:200746502-200746524 GCCCCTCAGGGCTGGATTCCAGG - Intergenic
944946440 2:204692124-204692146 GCTCCTGTGAGCTGGTTTCTAGG - Intronic
945031913 2:205673469-205673491 TTTCCTGACTGCTGGTTTCCTGG + Intergenic
946692175 2:222318613-222318635 CCGCCTGAAAGCTGGTTTTCTGG - Intergenic
947974711 2:234355675-234355697 GCCCCTGGCTGCTGCTTTCCAGG + Intergenic
948696854 2:239737172-239737194 GCTCCTGAGTGCTTCTCTCCAGG + Intergenic
1168854234 20:997603-997625 TCCCCTGAGTGCTGGCATCCAGG - Intronic
1170930299 20:20763705-20763727 GGGTCTGAGTGCTGGTTACAAGG + Intergenic
1170931416 20:20772346-20772368 GTGCCTGAGGGTGGGTTTCCTGG + Intergenic
1172548431 20:35780175-35780197 GTGCCTCAGTGCTGGTTTCCAGG - Intronic
1175923120 20:62459175-62459197 GGGCCTGGGTGCTTGTTCCCTGG + Intergenic
1183169974 22:36180552-36180574 GCGCCTGCCTCCTGATTTCCAGG + Intergenic
1184884319 22:47332861-47332883 GAGCCTGACTGCTGGTGCCCTGG + Intergenic
958041406 3:88230744-88230766 GGGCCTGAGTGGTGGTTTCCAGG - Intergenic
961325722 3:126108253-126108275 GACCCTGAGAGCTGGTCTCCTGG + Intronic
961410516 3:126716976-126716998 GGGCCTGAGTGCTGCTTAGCAGG + Intronic
961780878 3:129319445-129319467 CAGCCTGAGTCCTGGTCTCCTGG - Intergenic
962389630 3:134960397-134960419 GAGCTTGAGTGCTAGTTACCTGG + Intronic
966769731 3:183492949-183492971 TTGCCTGAGAGCTGGATTCCGGG - Intronic
967013106 3:185457443-185457465 GGGCCTGAGTTCTGGTTTATAGG + Intronic
967174751 3:186853109-186853131 GCCCTTGAGTCGTGGTTTCCTGG - Exonic
967846918 3:194051587-194051609 GAAGCTGAGGGCTGGTTTCCTGG - Intergenic
969444350 4:7235585-7235607 GCCCCTGAGGGGTGGCTTCCTGG + Intronic
969570793 4:8006914-8006936 GTGCCTGAATGCTGGGATCCTGG + Intronic
969964975 4:10984707-10984729 GCACCTGAGGGCAGGTTTCTAGG - Intergenic
971248245 4:24949710-24949732 GAGCCCGAGTCCTGCTTTCCTGG - Intronic
973694868 4:53480912-53480934 TCTCCTGAGTTCTGGTTTCATGG - Intronic
977358937 4:95980443-95980465 GTCCCTGAGTGCTGGTGTCATGG + Intergenic
977919294 4:102625702-102625724 GGGCCAGGGTGCTGGCTTCCTGG - Intergenic
987088804 5:14492735-14492757 GCAGCTGAGGGCTGGATTCCAGG + Exonic
1000284623 5:159816423-159816445 GCCCCTGCTTGCTGGTTTCATGG - Intergenic
1001552153 5:172610928-172610950 GCCCATGATTGCAGGTTTCCTGG + Intergenic
1004280650 6:14276837-14276859 GCTCCTGAGTCCTGGGCTCCTGG + Intergenic
1004505302 6:16242355-16242377 TTGCCTGTATGCTGGTTTCCTGG + Intronic
1007032906 6:38644604-38644626 GGGCCTGAGGGAAGGTTTCCTGG - Intergenic
1010450209 6:75994004-75994026 GCTGCTGTGTGCTGGTTTTCTGG + Intronic
1014727009 6:124983443-124983465 GAGCCTGAGTGATGGTTTAGTGG + Intronic
1018905255 6:168072166-168072188 CCGCCTGGGTGATGGATTCCTGG + Intronic
1019258853 7:68782-68804 GCCCCTGGGTGCTGCTTACCGGG + Intergenic
1024580161 7:50794140-50794162 CCGCCTGAGGGTTGGTGTCCTGG + Intergenic
1025015997 7:55439619-55439641 GGGCCTGGGGGCTGGTGTCCCGG + Intronic
1030105115 7:105980843-105980865 GTGAATGAATGCTGGTTTCCGGG + Intronic
1033367170 7:140680522-140680544 GCACCAGAGAGCTGGTTTCTGGG - Intronic
1034419032 7:150979360-150979382 GCGTCTGAGTGAGGGTCTCCGGG + Intergenic
1035485253 7:159218420-159218442 GCCCTTGAGTGGAGGTTTCCAGG - Intergenic
1037502585 8:19499876-19499898 GTGCCTGGGTACTGGATTCCCGG + Intronic
1038331334 8:26611834-26611856 GCGCCTGAGTCCCTCTTTCCGGG - Intronic
1048212262 8:132465112-132465134 GTGCTGGAGTTCTGGTTTCCTGG - Intronic
1053707452 9:40769096-40769118 CGCCCTGAGTGCTGGTTTGCAGG + Intergenic
1054417364 9:64889864-64889886 CGCCCTGAGTGCTGGTTTGCAGG + Intergenic
1055372036 9:75610701-75610723 TCCCCTGAGTGCTGCTTTCCTGG + Intergenic
1057018565 9:91677832-91677854 GCACCTGTGTGCAGGTTCCCAGG - Intronic
1057547551 9:96029440-96029462 TGGTCTGCGTGCTGGTTTCCTGG + Intergenic
1057865125 9:98674437-98674459 GGCCCTGAGTGCTGGGTGCCTGG + Intronic
1059699011 9:116757229-116757251 CCGGGTAAGTGCTGGTTTCCTGG - Intronic
1061307284 9:129739496-129739518 GGCCCTGAGTCCTGGTTTCCTGG - Exonic
1061771514 9:132927242-132927264 CCGGCTGAGAGCTGGTTTCCAGG + Exonic
1062110035 9:134777309-134777331 GCTCCTGAGTGCTCCTTCCCGGG + Intronic
1062421292 9:136483853-136483875 GCGCCTGCGCGCTGGTTGCCTGG + Exonic
1189333347 X:40155923-40155945 GCGCCTGGGTGCAGGCCTCCAGG - Intronic
1191915950 X:66201278-66201300 GCTCCTGTGTTCTGATTTCCAGG - Intronic