ID: 1160942009

View in Genome Browser
Species Human (GRCh38)
Location 19:1624659-1624681
Sequence GGCGCCTGAGTGCTGGTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160942009_1160942014 9 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942014 19:1624691-1624713 ACTCACGGACGTGCGCACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 47
1160942009_1160942016 24 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942016 19:1624706-1624728 CACAGTGGGAAAAGTTCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 98
1160942009_1160942017 30 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942017 19:1624712-1624734 GGGAAAAGTTCGAGTGGCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1160942009_1160942011 -6 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942011 19:1624676-1624698 GGCGCCTTCCTGATCACTCACGG 0: 1
1: 0
2: 0
3: 6
4: 88
1160942009_1160942015 10 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160942009 Original CRISPR GGCGCCTGAGTGCTGGTTTC CGG (reversed) Intronic
900243544 1:1627696-1627718 TGCTCCTGAGTGCTGGGTGCCGG + Exonic
900658576 1:3772201-3772223 TGGGCCTGAATGCTGGGTTCGGG - Intergenic
902656042 1:17869079-17869101 TGGGCTTGAGTGCTGGGTTCTGG - Intergenic
904734326 1:32618998-32619020 GGCTCAAGAGTGCTGGTTACAGG - Intronic
904778394 1:32925906-32925928 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
905240424 1:36577409-36577431 GAGGCCTGAGTGCGGGTGTCTGG + Intergenic
911538036 1:99124137-99124159 GGGTCCTGAGTGCTTGTTGCTGG + Intergenic
918123130 1:181557149-181557171 GTCACCTGGGTGCTGGCTTCTGG + Intronic
922526569 1:226308911-226308933 GGTGTCTGTGTGTTGGTTTCTGG - Intronic
922616505 1:226964221-226964243 GGCTCCTGGGTGCTGTTTCCTGG + Intronic
922684366 1:227627733-227627755 GCCAGCTGAGTGCTAGTTTCTGG + Intronic
923480441 1:234378573-234378595 GGCCCATCAGTGCAGGTTTCTGG - Intronic
923688898 1:236174422-236174444 GCCTCTTGAGTGCTGGGTTCTGG + Intronic
1065643176 10:27805629-27805651 GGCGCCTGTGAGCTGAGTTCTGG - Intergenic
1071519136 10:86318202-86318224 AGCACCTGAGTGCTGGTGCCAGG + Intronic
1075413640 10:122247173-122247195 GGCTGCTGAGTGCTGGCTTAGGG + Intronic
1075795343 10:125116147-125116169 GGGGGCTGAGTGCTGGGTTCGGG - Intronic
1076822534 10:132946629-132946651 GGATCCTGAGTGCTGGGTGCAGG - Intergenic
1077431141 11:2516593-2516615 TGCACCTGTGTGTTGGTTTCAGG - Intronic
1077593975 11:3515798-3515820 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1081152462 11:39648670-39648692 GAAGCCTGAGTGCTGGGATCAGG - Intergenic
1084249772 11:67888522-67888544 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1088501337 11:110486440-110486462 GGTTCTTGGGTGCTGGTTTCTGG + Intergenic
1089407726 11:118212352-118212374 AGCCCCTGACTGCTGGTGTCAGG - Intronic
1090566883 11:128004355-128004377 GGCCCCTGAGTGATGATTTATGG + Intergenic
1091223407 11:133944156-133944178 GGTGCCTGAGGGCTGTTTCCGGG - Intronic
1092007955 12:5085531-5085553 GGAGCCTGAGTGATGGTCTCTGG - Intergenic
1092420073 12:8323934-8323956 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1101434934 12:104656438-104656460 GGAGCCTGAGTGCTGTGCTCAGG - Intronic
1104361942 12:128141646-128141668 GGGCCCTGAGTGCAGGTTTTGGG + Intergenic
1105948742 13:25211381-25211403 AGGGCCTCACTGCTGGTTTCAGG - Intergenic
1107831130 13:44374253-44374275 GGGGGCTGAGAGCTGGGTTCAGG + Intronic
1111721878 13:91956236-91956258 GGCTCCTGAGTGCTTTTTCCAGG + Intronic
1113793264 13:113041796-113041818 GGAGGCTGAGTGCTGGTGTGTGG + Intronic
1113854796 13:113437274-113437296 TGCGCCTGGGTGCTGGGTCCCGG - Intronic
1113854817 13:113437358-113437380 TGCGCCTGGGTGCTGGGTCCTGG - Intronic
1114169987 14:20262658-20262680 GGTCCCTGAGTGCCAGTTTCGGG + Intronic
1117579652 14:57139361-57139383 GGCGCTTGCGTGCTTGCTTCTGG - Intergenic
1119609406 14:76048888-76048910 GGTGCCTCAGTTCTGGTTGCTGG - Intronic
1121624800 14:95375807-95375829 GGCACCTGAGTCCTTGCTTCAGG + Intergenic
1122042270 14:98997274-98997296 AGCTCCTGAGAGCTGGTTTAAGG + Intergenic
1122427745 14:101621493-101621515 TGAGCCTGAGTGCTGATTCCCGG + Intergenic
1122796108 14:104207047-104207069 GGCGCCTGGGTGCTGGCCTTGGG + Intergenic
1128534249 15:68478908-68478930 GGCACCTGAATGCTGGCTCCAGG - Intergenic
1129772235 15:78209602-78209624 GGCCCCTGAGCTCTGGGTTCAGG + Intronic
1134163976 16:11915621-11915643 GGCGCCTGACTGCTGGGACCAGG - Exonic
1135069318 16:19338405-19338427 GGAGCCTGCTTGCTGGTTTGTGG - Intergenic
1139937747 16:70583609-70583631 GGGCCCTGGGTGCTGGGTTCTGG + Intronic
1142021449 16:87785392-87785414 GGGGCCAGAGTGCTGGGTTGGGG + Intergenic
1147139885 17:38454798-38454820 GGCTCCTGGGTTCTAGTTTCTGG + Intronic
1148334626 17:46832944-46832966 GGAGCCAGAATGCAGGTTTCTGG - Intronic
1151280186 17:73068189-73068211 GGCTCCAGAGTGGTTGTTTCTGG + Intronic
1151367743 17:73628301-73628323 GGCTTATGAGTGCTGGATTCAGG - Intronic
1151888483 17:76938210-76938232 GGGGCCTGAGTGGTGGTGGCAGG - Intronic
1154031768 18:10759440-10759462 GGCCACAGAGTGCTGGTATCCGG - Intronic
1154092635 18:11379332-11379354 GGCCTCTGTGTGCTTGTTTCTGG - Intergenic
1160751112 19:735149-735171 GGTGCCTGTGTCCTGGTGTCTGG + Intronic
1160751127 19:735198-735220 GGTGCCTGTGTCCTGGTGTCTGG + Intronic
1160844688 19:1161168-1161190 GGTGCCTGAGTACTGGGTACTGG + Intronic
1160844711 19:1161227-1161249 GGTGCCTGAGTACTGGGTACTGG + Intronic
1160844746 19:1161332-1161354 GGTGCCTGAGTACTGGGTACTGG + Intronic
1160844751 19:1161356-1161378 GGCGCCTGAGTACTGAGTACTGG + Intronic
1160844762 19:1161386-1161408 GGTGCCTGAGTACTGGGTACTGG + Intronic
1160844769 19:1161410-1161432 GGTGCCTGAGTACTGGGTACTGG + Intronic
1160942009 19:1624659-1624681 GGCGCCTGAGTGCTGGTTTCCGG - Intronic
1161170339 19:2809502-2809524 GGCGCCGCAGTGCTGGCCTCTGG + Intronic
1163927910 19:20362845-20362867 GGGGACTGAGTCCTGGTTTCTGG + Intergenic
1164227504 19:23258697-23258719 GCTGCCTGTGTGCTGCTTTCAGG - Intergenic
1164661561 19:29975802-29975824 GGCCCCTCAGTTCTGTTTTCTGG + Intronic
1165523107 19:36330032-36330054 GGGGACTGAGTCCTGGTTTCTGG - Intergenic
1165611584 19:37158374-37158396 GGCACATGAGAGCTGGTTTGTGG - Intronic
1166231453 19:41427540-41427562 GGCGTGTTAGGGCTGGTTTCTGG + Exonic
1166777858 19:45323410-45323432 GGCGCCCAAGCGCGGGTTTCTGG - Intergenic
1167498965 19:49835193-49835215 GGGGTCGGAGTGCTGGTTTGGGG - Intronic
925235649 2:2275052-2275074 GGAGCCAGTGTGCTGGTTTGGGG + Intronic
926170713 2:10550960-10550982 GGAGCCTGAGTGCTGGTGGATGG - Intergenic
927070752 2:19526928-19526950 GCCGCCTGGGTGCTGGCCTCTGG - Intergenic
927494657 2:23544325-23544347 GGTGCCTGAGAGCAGGTCTCCGG + Intronic
927508096 2:23627503-23627525 AGCGCCTGAGTGTGGGTCTCAGG - Intronic
932840375 2:75076664-75076686 GGCTCCTGACTCCTGGTCTCGGG - Intronic
937128796 2:119491348-119491370 GGAGCCTGACTGGTGGTTGCTGG - Intronic
937925546 2:127165062-127165084 GGCTCCTGAGTGCTGGGCTCGGG + Intergenic
946250227 2:218406859-218406881 GCCGCCTGGGGGCTGGATTCAGG - Intergenic
946551342 2:220804948-220804970 GGCACCTGAGTGCTGAATTCAGG + Intergenic
949046816 2:241876300-241876322 GGCCCCTGAGACCTGGATTCAGG - Intergenic
1173570311 20:44071609-44071631 GGGGCTTGGGTGGTGGTTTCGGG - Intergenic
1173873150 20:46354165-46354187 GGCTCCTGTGTGCTGGCTCCTGG + Intronic
1175885076 20:62285547-62285569 GGCTCCTGTGTGGGGGTTTCAGG - Intronic
1176080213 20:63268777-63268799 ACCGCCAGTGTGCTGGTTTCAGG - Intronic
1178839365 21:36126531-36126553 TGTGCCTGAGTGCTGGGGTCAGG - Intergenic
1183007399 22:34914886-34914908 GGCGCCTGACTTCTGCTTCCTGG - Intergenic
1183280283 22:36928577-36928599 GGCACCTGATTTCTGGTTTCTGG - Intronic
1183475216 22:38032455-38032477 GGCTCCTGACTGATGGATTCAGG - Intronic
1184625220 22:45722092-45722114 GCAGCCTGAGTGATGATTTCTGG + Intronic
949522870 3:4872670-4872692 TGCGTCTGTGTGCTGGTCTCTGG - Intronic
953358703 3:42276375-42276397 GGCTTCTGAGTGCTGGGTGCAGG + Intergenic
953919041 3:46939404-46939426 GGAGCCTGAGTTCCAGTTTCTGG - Intronic
954635776 3:52070081-52070103 GGCGCATGAGTGCTGCTGCCTGG + Intergenic
957064015 3:75506479-75506501 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
961289335 3:125832904-125832926 GAGGACTGAGTCCTGGTTTCTGG + Intergenic
961897757 3:130183126-130183148 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
968810926 4:2799377-2799399 GGGTCCTGGGTGCTGGCTTCAGG + Intronic
969007923 4:4036690-4036712 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
969458228 4:7313309-7313331 GCCTCCTGAGTGCTGGGCTCTGG + Intronic
969493758 4:7514385-7514407 GGGGCAGGAGTGCTGGTGTCTGG - Intronic
969745694 4:9069361-9069383 GAGGACTGAGTCCTGGTTTCTGG + Intergenic
969805051 4:9600812-9600834 GAGGACTGAGTCCTGGTTTCTGG + Intergenic
1000286698 5:159833156-159833178 GGCCACTGAGTGCAGGTTACAGG + Intergenic
1001358439 5:171056276-171056298 TGCTCCTGAATGCAGGTTTCTGG - Intronic
1006082527 6:31575633-31575655 GGCGTCTGAGGGTTGTTTTCAGG - Exonic
1006188615 6:32194362-32194384 GGCGACGGAGGGCTGGTTTCAGG + Intronic
1006514455 6:34538236-34538258 GGCCCCTGAGGGCGGGTTTCAGG + Exonic
1006739162 6:36295028-36295050 GGAGCCTGAGTTCAGGTCTCTGG - Intronic
1007346244 6:41231265-41231287 GGCGCCTGAGAACTGTTTTGTGG - Intronic
1007421014 6:41719812-41719834 AGGGCCTGAGTTCTGGATTCGGG - Intronic
1007635644 6:43298215-43298237 AGCCCCTGAGGGCTGGATTCTGG + Intronic
1012765157 6:103357928-103357950 GGCGCCTGAGAACTCCTTTCAGG + Intergenic
1018378179 6:163232897-163232919 GAGGGCTGAGGGCTGGTTTCGGG - Intronic
1019548343 7:1589449-1589471 GGTGCAGGGGTGCTGGTTTCTGG - Intergenic
1020328444 7:6994820-6994842 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1032496261 7:132365070-132365092 GGCTCCTGAGAGCTGGATTTGGG + Intronic
1033025260 7:137766046-137766068 AGGGGCTGAGAGCTGGTTTCAGG - Intronic
1033367171 7:140680523-140680545 GGCACCAGAGAGCTGGTTTCTGG - Intronic
1034080176 7:148269302-148269324 TGTGCCTGAGTGCTGTTTTCAGG - Intronic
1034453949 7:151154711-151154733 GGAGCATGAGTGCTGTTCTCTGG - Intronic
1035355682 7:158274779-158274801 GGAGCCTGACTGCAGCTTTCTGG + Intronic
1036017457 8:4800808-4800830 GGCACCTGAGTGGTGGGTGCAGG + Intronic
1036249265 8:7147749-7147771 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1036368182 8:8139292-8139314 GAGGACTGAGTCCTGGTTTCCGG + Intergenic
1036882703 8:12526355-12526377 GAGGACTGAGTCCTGGTTTCCGG - Intergenic
1037485910 8:19346581-19346603 GGCGCCAGAGGGATGGCTTCGGG - Intronic
1038331335 8:26611835-26611857 GGCGCCTGAGTCCCTCTTTCCGG - Intronic
1040109399 8:43560289-43560311 GAGGACTGAGTCCTGGTTTCTGG - Intergenic
1042784866 8:72536609-72536631 GGCTCCTGAGTGGTGGTGCCAGG - Intergenic
1049023124 8:139971110-139971132 GGAGCCTGGGTGCTGATCTCGGG - Intronic
1055146950 9:72947286-72947308 TGTGGCTGAGTGCTAGTTTCTGG + Intronic
1056070560 9:82982528-82982550 GGGACCTGAGAGCTGGGTTCAGG + Exonic
1056923866 9:90815584-90815606 GGAGCCTGAGTGCTGGTGGTGGG - Intronic
1200691168 Y:6307075-6307097 GGCCCTTGTGTGCTGGGTTCTGG - Intergenic
1201044104 Y:9867641-9867663 GGCCCTTGTGTGCTGGGTTCTGG + Intergenic