ID: 1160942010

View in Genome Browser
Species Human (GRCh38)
Location 19:1624666-1624688
Sequence TCAGGAAGGCGCCTGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160942010_1160942016 17 Left 1160942010 19:1624666-1624688 CCAGCACTCAGGCGCCTTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1160942016 19:1624706-1624728 CACAGTGGGAAAAGTTCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 98
1160942010_1160942017 23 Left 1160942010 19:1624666-1624688 CCAGCACTCAGGCGCCTTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1160942017 19:1624712-1624734 GGGAAAAGTTCGAGTGGCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 110
1160942010_1160942015 3 Left 1160942010 19:1624666-1624688 CCAGCACTCAGGCGCCTTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1160942010_1160942014 2 Left 1160942010 19:1624666-1624688 CCAGCACTCAGGCGCCTTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1160942014 19:1624691-1624713 ACTCACGGACGTGCGCACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160942010 Original CRISPR TCAGGAAGGCGCCTGAGTGC TGG (reversed) Intronic
900353353 1:2247821-2247843 TCGGGAAGGGGCCTTACTGCTGG + Intronic
900389419 1:2427553-2427575 TCAGGAAGCCCCCTGAGGGCAGG - Intronic
900466147 1:2826434-2826456 TGAGGAAGGCGCCTGTGGTCAGG + Intergenic
900518081 1:3092662-3092684 GCTGGATGGCGCCTGGGTGCGGG + Intronic
900680645 1:3914519-3914541 CCAGGAATGCGGCTGAGCGCGGG + Intergenic
900784445 1:4638909-4638931 TCAGGACGCAGACTGAGTGCAGG + Intergenic
901259510 1:7861318-7861340 TCAAGAAGGCAGCTGAATGCTGG + Intergenic
902326808 1:15706223-15706245 TCAAGAAGGCAGCTGAGGGCCGG - Intronic
902509383 1:16957854-16957876 TCAGGAAGGGGCCTGGGTGAAGG - Intronic
904447488 1:30586962-30586984 TGGGGAAGGCACCTGGGTGCAGG - Intergenic
905091706 1:35435498-35435520 TCAGCAAGGCCGCTGAGTGCTGG + Intronic
905284786 1:36872173-36872195 TCAAGCAGGTGCGTGAGTGCTGG - Exonic
905471356 1:38194479-38194501 TCAGGAAAGTGCCTGGGGGCTGG - Intergenic
909101289 1:71352471-71352493 TCAGGAAGGCAAATGAATGCAGG - Intergenic
909631965 1:77777182-77777204 TCTGGAAGGATCCTAAGTGCAGG - Intergenic
911846958 1:102765775-102765797 TCTGGAAGGAGCCTGAGTGTAGG - Intergenic
913171854 1:116240360-116240382 TCTGGAAGGATCCTGAGTGTAGG - Intergenic
915971552 1:160358640-160358662 TCAGGAAGGTGGCTGGGTACAGG - Exonic
916920208 1:169458483-169458505 TCTAGAAGGGTCCTGAGTGCAGG + Intronic
916994796 1:170284866-170284888 TCAGAAAGGCTCCAGAGTGGAGG + Intergenic
922153022 1:223021228-223021250 TCAGGAAGGAGCCAGGGTGGAGG + Intergenic
923633933 1:235675633-235675655 TCTGGAAGTGCCCTGAGTGCTGG - Intronic
923847454 1:237751106-237751128 TCATGAGGGCGCCAGAGTGTTGG - Intronic
923878228 1:238074574-238074596 TCAGGAAAGAGAGTGAGTGCAGG + Intergenic
924513766 1:244749685-244749707 GCATGAAGGAGCCTGGGTGCTGG - Intergenic
1064346383 10:14536541-14536563 ACAGGCAGGAGCCTGAGTTCCGG + Intronic
1067069617 10:43122165-43122187 TCATGAAGGCCCCTCAGTGAGGG - Intronic
1068772747 10:60840639-60840661 TCAGGAAGCAGCCTGGGTGAGGG - Intergenic
1069875417 10:71560023-71560045 GCAGGAAGGCACTTGAGCGCAGG - Intronic
1069878615 10:71578148-71578170 CCAGGAAGGTGACTGAGTGAAGG + Intronic
1070704289 10:78626528-78626550 TTGGGAAGGTGCCTGAGAGCCGG + Intergenic
1070965788 10:80529477-80529499 TCAGGAAGGGCCCTTAGTGATGG + Exonic
1071092528 10:81935742-81935764 TCAGGAAGGCTCCTCAGAGGAGG - Intronic
1072552096 10:96486920-96486942 TCAGGAGGACGCCTGAGCACTGG - Intronic
1073196245 10:101694543-101694565 TCCGGCAGGCGCCAGAGCGCAGG + Exonic
1074832296 10:117257441-117257463 TCTGGAAGTGGCCTGATTGCTGG + Intronic
1075522996 10:123155076-123155098 CCAGGACGGCGCCGGTGTGCTGG - Exonic
1076696318 10:132249095-132249117 GCAGCAAGGCGCATGCGTGCCGG + Intronic
1077233905 11:1470775-1470797 TCAGGAAGGGGCCTGTGATCGGG + Intronic
1077968836 11:7166127-7166149 TCAGGCAGGCCCCAGAGTCCAGG + Intergenic
1078813417 11:14794909-14794931 TCTGGAAGGGGCCTGAGTACAGG + Intronic
1079087461 11:17456903-17456925 TCAGGCAGTGGGCTGAGTGCTGG + Intronic
1079103046 11:17553236-17553258 CCAGGAAGGGACCTGGGTGCAGG + Intronic
1080289826 11:30658480-30658502 TCTGGAAGGGTCCTGAGAGCAGG + Intergenic
1081596853 11:44465442-44465464 TCTGGAAGGAGCCTGAGTGTGGG - Intergenic
1083644571 11:64165110-64165132 CCAGGAAGGCATCAGAGTGCGGG + Intronic
1084399280 11:68934336-68934358 CCAGGAAGCCACCTGAGTGGAGG + Intronic
1085408372 11:76277427-76277449 ACAGGAAGCCGCCTGGGTGTGGG - Intergenic
1087258767 11:95986735-95986757 TCAGGAAAGAGCCTGAGTTTTGG - Intronic
1087846745 11:102982262-102982284 TTAGGAAGTCGCCTGAGCCCAGG - Intergenic
1088716188 11:112551806-112551828 TTAGGAAGGACCTTGAGTGCCGG - Intergenic
1089874237 11:121704628-121704650 TGAGGAAGGAGCCAGAGTGTAGG + Intergenic
1089957326 11:122583865-122583887 GCAGGAAGGAGAATGAGTGCAGG - Intergenic
1090068239 11:123522069-123522091 TCAGGAAGCAGCCAGATTGCAGG + Intergenic
1093685177 12:22046540-22046562 TCTGGAAGGCCCCTGAATCCAGG - Exonic
1095701443 12:45194958-45194980 TGGGGAAGGAGCCTGAGAGCGGG - Intergenic
1096527558 12:52220579-52220601 TCTGGAAGGGTCCTGAGTGCAGG + Intergenic
1097626128 12:62002700-62002722 TCAGGAAGGGGCCAGAGTGTTGG - Intronic
1099334300 12:81333958-81333980 TCAAAATGGGGCCTGAGTGCTGG - Intronic
1099580763 12:84444287-84444309 TCTGGAAGGATCCTGAGTGCAGG - Intergenic
1102214606 12:111151752-111151774 TCTGGGAGGCTCCTGAGGGCTGG + Intronic
1104361940 12:128141639-128141661 ACAGTAAGGGCCCTGAGTGCAGG + Intergenic
1105513117 13:21067564-21067586 TCTGGAAGAGTCCTGAGTGCTGG - Intergenic
1107853972 13:44596643-44596665 TCAGGAGGCTGGCTGAGTGCGGG + Intergenic
1108255040 13:48601742-48601764 ACAGGAAGGGGGCTGATTGCTGG - Intergenic
1111781110 13:92725988-92726010 TCAGGATGGTGCATCAGTGCTGG - Intronic
1112234748 13:97625232-97625254 TCTGGAAGGCTTCTGAGTGCTGG - Intergenic
1114590790 14:23862916-23862938 TGAGGAAGGATCCAGAGTGCTGG - Intergenic
1114594639 14:23900816-23900838 TCAGCAAGGGTCCTGAATGCAGG - Intergenic
1115654176 14:35427394-35427416 TCAGGAAGGCCTCTGTGTGGAGG + Intergenic
1115850071 14:37584002-37584024 CCAGGACTGCGCCTGTGTGCGGG + Intergenic
1118137730 14:63046575-63046597 CAAGGAAGGTGCCTCAGTGCGGG - Intronic
1118629629 14:67690753-67690775 GCAGGAAGGTGCCTGAGGCCAGG + Intronic
1119791998 14:77359313-77359335 CCTGGAAGGGTCCTGAGTGCAGG - Intronic
1120362639 14:83524971-83524993 TGAGGAAGGCATCTGCGTGCAGG + Intergenic
1120441275 14:84543675-84543697 TCATGAGGGAGCCTGAGTTCAGG - Intergenic
1122136732 14:99637666-99637688 TCCTGAAGGCGACTGTGTGCAGG - Intergenic
1123025353 14:105421298-105421320 TCAGGGAGCAGCCTGGGTGCGGG + Intronic
1124045381 15:26144851-26144873 ACAGGAATGTGCCTGTGTGCAGG - Intergenic
1126136528 15:45397547-45397569 TCTGGAAGGGTCCTGAGTACAGG - Intronic
1128535163 15:68484990-68485012 TCATGAAGGTGCCTGAGTGATGG - Intergenic
1128571818 15:68739127-68739149 TCTGCAAGGGTCCTGAGTGCGGG - Intergenic
1129367929 15:75068451-75068473 TCAGAAAGGACCCTGAGGGCAGG - Intronic
1129678308 15:77644036-77644058 CCTGGAGGGCTCCTGAGTGCCGG - Intronic
1130391339 15:83458363-83458385 TCAGGAAGGCCACTGGCTGCTGG - Intronic
1131143637 15:89998306-89998328 CCAGGAAGGCCCCTGGGAGCAGG - Intergenic
1132629408 16:909752-909774 GCAGGCAGGGGCCCGAGTGCTGG - Intronic
1135013797 16:18906937-18906959 TCAGCAGGGCACCTGTGTGCAGG - Intronic
1139433422 16:66923329-66923351 TCCGGAAGGCCCCAGAGGGCTGG - Intronic
1139448217 16:67011668-67011690 TCAGTAAGGAGCCAGAGTGAGGG + Intergenic
1144230548 17:13198929-13198951 TCTGGAAGGGTCCTGAGTGCAGG + Intergenic
1144773861 17:17774398-17774420 TCAGAAAGGCCCCTGTGTTCCGG - Intronic
1146465950 17:33086864-33086886 ACAGGAAGGGGCTTGGGTGCTGG - Intronic
1146608410 17:34283269-34283291 TCAGGAATGATCCTGAGTGATGG - Intergenic
1146639126 17:34526953-34526975 TCAGGAAGGCCCCTGCAAGCAGG + Intergenic
1148202220 17:45756745-45756767 TAATGAAGGTGCCTGATTGCAGG + Intergenic
1149341837 17:55694936-55694958 ACAGGAAGGGGACTGAATGCCGG - Intergenic
1149650340 17:58272600-58272622 TCAGGAAGTAGCCTGAGGCCAGG - Intronic
1151888485 17:76938217-76938239 TGTGGAAGGGGCCTGAGTGGTGG - Intronic
1152592674 17:81221635-81221657 CAAGGAAGGCCTCTGAGTGCAGG - Intronic
1153775291 18:8447971-8447993 TCTGGAAGGGTCGTGAGTGCAGG + Intergenic
1155378383 18:25188182-25188204 TCAGGATGGCGCCTGTGGCCCGG - Intronic
1157553544 18:48597817-48597839 TGAGGAAGCAGCCTGTGTGCTGG + Intronic
1157747719 18:50151025-50151047 AGAGGAAGGCTCCTGAGAGCTGG - Intronic
1159131863 18:64288744-64288766 TCTGGAAGGGTCCTGAGTGCAGG - Intergenic
1160942010 19:1624666-1624688 TCAGGAAGGCGCCTGAGTGCTGG - Intronic
1161042979 19:2120028-2120050 TCAGGAAGGCGCCTGACTTCTGG - Intronic
1161388645 19:4009937-4009959 TCAGGAAGGCGCCTCTCTCCAGG - Intronic
1162312422 19:9914808-9914830 CCAGGAGGGGGCGTGAGTGCAGG - Intronic
1163326130 19:16604495-16604517 TCAGGAACGCCCAGGAGTGCAGG + Intronic
1164620785 19:29694991-29695013 TAAGGAAGACGCCTGGGTACAGG - Intergenic
1164803354 19:31096274-31096296 TCAGGAAGGAGCCGGAGCTCCGG + Intergenic
1166042290 19:40211272-40211294 TCAGGCAGGGCCCTGAGAGCAGG + Intronic
1166106112 19:40598786-40598808 TCAGGATGGCGTCTGAGTCCCGG + Intronic
1168319645 19:55501174-55501196 TCCGGCAGGCGCCTTATTGCTGG - Exonic
1168321512 19:55513055-55513077 TCAGGAAGGGGCCTGGCTGAGGG + Exonic
1168485732 19:56760337-56760359 TCAGACAGGAGCCTAAGTGCGGG - Intergenic
926844286 2:17117423-17117445 TCAGGCAGTGGCATGAGTGCTGG - Intergenic
932081411 2:68719089-68719111 TCTGGAAGGGCTCTGAGTGCAGG - Intronic
932402198 2:71488831-71488853 GCAGAAAGGCATCTGAGTGCAGG - Intronic
932463570 2:71898641-71898663 TCAGAAATGCGCCTGAGGCCAGG - Intergenic
932493327 2:72134706-72134728 TCAGAATGGAGCCTGGGTGCTGG + Intronic
934966997 2:98731534-98731556 GCAGGCAGGCGCCTGGGAGCTGG - Intergenic
936382335 2:111997604-111997626 TCAGGAAGCTGCCTGAGCCCAGG - Intronic
936491439 2:112976153-112976175 TCAGGATGGATGCTGAGTGCTGG + Intronic
937312612 2:120911362-120911384 TCAGGAAGGCTCCAGTGTGAAGG + Intronic
940113250 2:150179011-150179033 TCAGAAAGGTTACTGAGTGCAGG + Intergenic
941808438 2:169733382-169733404 TCAGGAGGGCGCCTTGGTGCTGG - Intronic
946305983 2:218857353-218857375 TCTGGAATGGGACTGAGTGCAGG + Intergenic
946371254 2:219282877-219282899 TAAAGAAGGGGCCTGAGTGTCGG - Exonic
946634405 2:221708228-221708250 TCGGGAAGGTGCCCCAGTGCAGG + Intergenic
948567663 2:238896955-238896977 GGAGGGAGGCGCCTGAGTGAAGG + Intronic
948621699 2:239239360-239239382 TCTGGAGGGGTCCTGAGTGCAGG + Intronic
948781681 2:240325360-240325382 TCAGGATGCTGCCGGAGTGCTGG - Intergenic
948807764 2:240460343-240460365 TCAGGAAGGCTCCTGACTCAGGG - Intronic
948824768 2:240568838-240568860 GACGGAAGGCGGCTGAGTGCAGG - Exonic
1172221618 20:33278046-33278068 GCAGGCAGCCGGCTGAGTGCTGG - Intronic
1173011247 20:39184668-39184690 TCTGGAAGGGTCCTGAGTACAGG + Intergenic
1173704248 20:45098435-45098457 TCAGGAAGAAGCCCGGGTGCCGG + Exonic
1173849985 20:46211583-46211605 GCAGGAGGGGGCCTGAGAGCTGG + Intronic
1174163700 20:48569770-48569792 TCAGGAGGCCGCCTGCTTGCTGG - Intergenic
1175225516 20:57441811-57441833 TGAGGAAGGCGCATGCGTGCTGG + Intergenic
1175760662 20:61560580-61560602 ACATGAAGGCGCTGGAGTGCAGG - Intronic
1176094483 20:63333648-63333670 CCAGGAAGGCGGGTGCGTGCAGG + Intronic
1176215954 20:63947864-63947886 GTTGGCAGGCGCCTGAGTGCCGG - Intronic
1181306506 22:21920183-21920205 GCAGGAGGGCCCCTGTGTGCTGG + Exonic
1181489602 22:23253380-23253402 TCAGGAAGGGGGCTGGTTGCCGG - Intronic
1181491519 22:23263205-23263227 TCCGGCAGGCGCCAGAGCGCTGG - Intronic
1181670887 22:24425008-24425030 TCAGGATGGCGACGGAGGGCTGG - Intronic
1181687905 22:24542211-24542233 TCAGGAGGCCTCCTGGGTGCAGG + Intronic
1185218494 22:49617026-49617048 TCAGGGAGGCGTCTGGGTGGTGG - Intronic
1185338020 22:50279462-50279484 TCAGGGAGGGGCCTGGGTGCTGG - Intronic
949210381 3:1491823-1491845 TCTGGAAGGGTCCTGAGTTCAGG + Intergenic
950002341 3:9666930-9666952 TCAGGAAGGCCCCTGTGGGAGGG - Intronic
950897460 3:16466567-16466589 TTAGGAAGGAGCCTGAGTTCAGG - Intronic
954453080 3:50582168-50582190 TCAGGAATGGGCCTGAGGCCAGG - Exonic
954718034 3:52536600-52536622 TCTGGTAGGCGCACGAGTGCCGG - Exonic
955413715 3:58673039-58673061 TGAGCAAGGCCTCTGAGTGCAGG - Intergenic
960747718 3:120908327-120908349 TGAGGAAGGTGCCTAAGTCCTGG + Exonic
963219980 3:142798476-142798498 TCAGGAAGGCTCCTTAGAGGAGG + Intronic
966183014 3:177204015-177204037 ACAGGGAGGCGGCTGAGCGCCGG + Intergenic
968650093 4:1757022-1757044 CCAGGAAGGAGTCTGAGGGCCGG + Intergenic
969487734 4:7481644-7481666 CCAGGGAAGCCCCTGAGTGCTGG - Intronic
973246900 4:48018769-48018791 ACAGTAAGGTGCCTGAGAGCAGG - Intronic
973798744 4:54455129-54455151 TCATGAAGGAGCCTGAGAGCAGG - Intergenic
974496156 4:62631173-62631195 TCAGGAATGCCAATGAGTGCAGG - Intergenic
974950191 4:68577564-68577586 TGAGGAAGGAGACTGAGTACAGG - Intronic
976813303 4:89120154-89120176 TCTAGAAGGGTCCTGAGTGCAGG + Intergenic
977920501 4:102637700-102637722 TCTGGAAGGGTCCTGAGTGCAGG - Intronic
981674279 4:147323157-147323179 TCAGGAAGGGACCTGAGTATGGG + Intergenic
984388434 4:179095692-179095714 TCAGGAAGGAGCCTGGAAGCAGG + Intergenic
987002729 5:13676655-13676677 TCAGGAAGTCACCTCAGTCCTGG + Intergenic
988371678 5:30377353-30377375 TCAGGAAGGTGCAGCAGTGCTGG + Intergenic
988564783 5:32312539-32312561 GCAGGCAGGTGCCTGAGCGCAGG - Intronic
989126206 5:38054574-38054596 TCTGGAAGGATCCCGAGTGCAGG - Intergenic
989539632 5:42604097-42604119 TCAGGAAGGGTCATGAGTACAGG + Intronic
989568181 5:42922149-42922171 TCAGGAAGGGGCCTCTGTGGAGG + Intergenic
990604540 5:57395667-57395689 TCTGGAATGGTCCTGAGTGCAGG + Intergenic
992002304 5:72447558-72447580 TCAGGAAGGAGCCTCAGAGGTGG + Intronic
995560556 5:113376716-113376738 CCAGAAAGGCGAATGAGTGCCGG - Intronic
997871058 5:137505448-137505470 GCAGGAAAGGGCCTGAGTGGAGG - Intronic
999217869 5:149950682-149950704 TCAGGAAGGCTCCAGAGAGCAGG + Intergenic
1002439668 5:179257789-179257811 TCAGGAGGCGGCCTCAGTGCTGG - Intronic
1003277703 6:4666534-4666556 TCAGGAAGGCACATGTGTGGAGG - Intergenic
1003556299 6:7142535-7142557 TCAGCAAGGCGCCTGGCAGCAGG - Intronic
1004007639 6:11651790-11651812 TCAGGGAGGGGGCTGAGAGCTGG + Intergenic
1006374532 6:33664657-33664679 TCAGGACGGGGCCTGGGCGCAGG + Intronic
1007801399 6:44396875-44396897 CCTGGAAGGGTCCTGAGTGCAGG + Intronic
1011686684 6:89829456-89829478 CCAGGAACGCGTCTGAGGGCAGG + Intergenic
1012621278 6:101347287-101347309 TCAGGAAGGCTTCTGAGAGGTGG + Intergenic
1013162625 6:107560506-107560528 TCAGGAAGGCTCCAGAGGTCAGG - Intronic
1016528902 6:145036584-145036606 GCAGCATGGCTCCTGAGTGCAGG - Intergenic
1016824016 6:148371740-148371762 GCATGGAGGGGCCTGAGTGCAGG - Intronic
1019473367 7:1232867-1232889 TAAGTAAAGCGCCGGAGTGCGGG + Intergenic
1020007764 7:4791465-4791487 TCAGGAGGGCGCGGGAGTCCTGG + Exonic
1025104596 7:56160802-56160824 GCATGAAGGCTCCTGAGTACAGG + Intergenic
1032084305 7:128875881-128875903 TCAGGAGAGGGGCTGAGTGCAGG + Intronic
1033316937 7:140305231-140305253 GCAGGAAGTCCCCTGAGAGCTGG + Intronic
1034550508 7:151817559-151817581 TCAGGAGGGTGCCTGCATGCGGG - Intronic
1034917948 7:155056425-155056447 TCTGGGAGGCTTCTGAGTGCAGG - Intergenic
1035141382 7:156766094-156766116 TCAGGTATGTGCCTGGGTGCTGG + Intronic
1036446546 8:8826202-8826224 TCTGGAAGGCGCCTGAGAAATGG - Intronic
1036766251 8:11550989-11551011 TCAGGAAGGAGCCCAAGTGGGGG - Intronic
1038298877 8:26323670-26323692 TCTGGAAGGGTCCTGAATGCAGG + Intronic
1040701800 8:50075076-50075098 TCAGGGAGGCGGCTGAGGCCTGG - Intronic
1041507200 8:58612397-58612419 GAAGGAAGGGTCCTGAGTGCAGG - Intronic
1047282632 8:123459292-123459314 TGTGGAAGGGTCCTGAGTGCAGG + Intronic
1049400418 8:142424244-142424266 GCAGGCAGGCACCTGAGTCCTGG - Intergenic
1049781197 8:144429755-144429777 CCAGGAAGGCCCCCGAGTGCTGG - Intronic
1052050619 9:23844099-23844121 TCAGGAAGGCTTCTCAGTGGAGG - Intergenic
1054892780 9:70270291-70270313 TCTGGAAGGGTCCGGAGTGCAGG + Intronic
1056804488 9:89718138-89718160 TCAGGAAGGCCTCTAAGGGCAGG + Intergenic
1057739244 9:97697384-97697406 TCAGAAAGGCCGCTGGGTGCGGG - Intergenic
1057813738 9:98278783-98278805 CCAGGCAGGTGTCTGAGTGCTGG + Intergenic
1058063649 9:100525476-100525498 TCCAGAAGGGTCCTGAGTGCAGG + Intronic
1060278128 9:122197661-122197683 TCAGGGAGGGGCCTGAGGACTGG + Intronic
1060356471 9:122913432-122913454 ACAGAAAGGCTCCTGAATGCCGG + Intergenic
1060730978 9:126036882-126036904 TGAGGAAGGAGCCTGCTTGCTGG + Intergenic
1060932425 9:127497418-127497440 TCAGGATGACTCCTGAGGGCTGG + Intronic
1061078555 9:128356330-128356352 GCAGGAAGGAGCTTGGGTGCTGG + Intronic
1061923126 9:133793123-133793145 GCAGGCAGGCGCCGGAGTGGGGG - Intronic
1062564897 9:137159937-137159959 TCAAGCAGGTGCCTGAGGGCAGG - Intronic
1203773289 EBV:60025-60047 TGCGGAAGCCGCCTGGGTGCGGG + Intergenic
1185719231 X:2369086-2369108 TCACGAAGGCTCCTCAGTGAAGG - Intronic
1190511236 X:51176148-51176170 TCTGGAAGGATCCTGAGTGAAGG + Intergenic
1190706413 X:53031788-53031810 TCTGGAAGGGTGCTGAGTGCAGG - Intergenic
1193241994 X:79181364-79181386 TCTGGAAGGATCCTTAGTGCAGG - Intergenic
1196366271 X:114927699-114927721 GCAGGAAGGCGAATGAATGCAGG - Intergenic
1198844090 X:140890822-140890844 TAAGAAAGGAGCCTGGGTGCTGG - Intergenic
1200108132 X:153725551-153725573 TCACCAAGGCGGCCGAGTGCAGG - Exonic