ID: 1160942015

View in Genome Browser
Species Human (GRCh38)
Location 19:1624692-1624714
Sequence CTCACGGACGTGCGCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160942008_1160942015 11 Left 1160942008 19:1624658-1624680 CCCGGAAACCAGCACTCAGGCGC 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1160942010_1160942015 3 Left 1160942010 19:1624666-1624688 CCAGCACTCAGGCGCCTTCCTGA 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1160942006_1160942015 17 Left 1160942006 19:1624652-1624674 CCGTAACCCGGAAACCAGCACTC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1160942009_1160942015 10 Left 1160942009 19:1624659-1624681 CCGGAAACCAGCACTCAGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160942015 Original CRISPR CTCACGGACGTGCGCACAGT GGG Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
904982974 1:34522351-34522373 ATCAAGGCCGTGCACACAGTAGG + Intergenic
910866779 1:91795903-91795925 CTCATGAACGTGTGCAGAGTTGG - Intronic
1068048558 10:51918896-51918918 CTCACGGGCTTGTACACAGTTGG + Intronic
1076809698 10:132880086-132880108 CACACACACGTGCGCACAGCAGG - Intronic
1084351232 11:68601293-68601315 CTCAGAGACGTGCACACAGAGGG - Intronic
1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG + Intergenic
1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG + Intergenic
1113610677 13:111642742-111642764 CTCACGCACGTGTGCACACCTGG - Intronic
1117794556 14:59378525-59378547 CTCACTGGCGTGAGCACAGCTGG + Intergenic
1131055240 15:89371079-89371101 CTCACGGAAGGTCGCACAGAAGG + Intergenic
1136458600 16:30396016-30396038 CTCCCGGCCTGGCGCACAGTTGG - Intronic
1156210692 18:34938339-34938361 CTCATGGACATGTGCAGAGTGGG - Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160896913 19:1407479-1407501 CTCAGGGACGCACGCACAGACGG + Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
928200515 2:29245073-29245095 CTCACTGCCCTGCACACAGTAGG + Intronic
937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG + Intergenic
939639851 2:144627342-144627364 TTCATGGACGTGCTCACAGTGGG - Intergenic
947119124 2:226798689-226798711 TTCTCGGACGTGCGCAAGGTGGG - Exonic
1169196832 20:3687736-3687758 CTCAGGGATGAGCTCACAGTTGG + Exonic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1179716328 21:43290628-43290650 CTCACACCTGTGCGCACAGTTGG - Intergenic
961403038 3:126660528-126660550 CTCACGGACCTGAGCAGAGGGGG + Intergenic
964242811 3:154616306-154616328 CTCAGGGATGTGCCCACTGTAGG - Intergenic
969718952 4:8882504-8882526 CTCAGGGCTCTGCGCACAGTAGG + Intergenic
970617438 4:17781344-17781366 CGCACGCACGTGCACACGGTGGG - Exonic
987476036 5:18393536-18393558 CTCACACAGGTGCTCACAGTGGG - Intergenic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG + Exonic
1034834173 7:154336676-154336698 CTGACTCACGTGCCCACAGTGGG - Intronic
1035688894 8:1547149-1547171 CACAGGGACGTGCGGACCGTGGG + Intronic
1040471558 8:47738641-47738663 CTCACGCGCGTGCCCACGGTCGG - Exonic
1044520511 8:93194045-93194067 CTGACGGACTAGCTCACAGTAGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG + Intergenic
1061443063 9:130619934-130619956 CTCATGGACCTGCCCTCAGTGGG + Intronic
1196815645 X:119663512-119663534 CTCACGATCGTTAGCACAGTTGG - Exonic
1199607486 X:149587446-149587468 GTCACTGACGTGCGCACTGGGGG - Exonic
1199631637 X:149781921-149781943 GTCACTGACGTGCGCACTGGGGG + Exonic