ID: 1160946836

View in Genome Browser
Species Human (GRCh38)
Location 19:1647638-1647660
Sequence CCCTTGGAGGTCTGGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160946836_1160946850 15 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946850 19:1647676-1647698 GGAAACAAAGGCCTGCTGTGGGG 0: 1
1: 0
2: 3
3: 15
4: 258
1160946836_1160946849 14 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946849 19:1647675-1647697 GGGAAACAAAGGCCTGCTGTGGG 0: 1
1: 0
2: 2
3: 25
4: 225
1160946836_1160946846 3 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946846 19:1647664-1647686 ACCTCTCATTTGGGAAACAAAGG 0: 1
1: 0
2: 1
3: 12
4: 189
1160946836_1160946848 13 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946848 19:1647674-1647696 TGGGAAACAAAGGCCTGCTGTGG 0: 1
1: 0
2: 6
3: 26
4: 342
1160946836_1160946844 -6 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946844 19:1647655-1647677 CAAGGGCCAACCTCTCATTTGGG 0: 1
1: 0
2: 1
3: 14
4: 163
1160946836_1160946843 -7 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946843 19:1647654-1647676 CCAAGGGCCAACCTCTCATTTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1160946836_1160946851 16 Left 1160946836 19:1647638-1647660 CCCTGGACCCAGACCTCCAAGGG 0: 1
1: 1
2: 0
3: 27
4: 208
Right 1160946851 19:1647677-1647699 GAAACAAAGGCCTGCTGTGGGGG 0: 1
1: 0
2: 4
3: 93
4: 1026

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160946836 Original CRISPR CCCTTGGAGGTCTGGGTCCA GGG (reversed) Intronic
900420200 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG + Intergenic
900424231 1:2568682-2568704 CCCTTGGAGGGCTGGAACCCAGG - Intergenic
900552038 1:3261686-3261708 TCCCTGGGGGTCTGGCTCCAGGG - Intronic
901444443 1:9299252-9299274 CCCTTGGCGGTCTGGGCTGATGG + Intronic
901477017 1:9496811-9496833 CCCTTGGCGGTCTGGGCTGATGG - Intergenic
903277586 1:22231710-22231732 CCCTGGGATGTCTGGGTTCATGG + Intergenic
903884178 1:26531411-26531433 CCTTTGGAGGCCTGGTCCCAGGG - Intronic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
905082874 1:35340340-35340362 CCCTCTGACGCCTGGGTCCATGG - Intronic
906103742 1:43279438-43279460 GCCTTGAAGGACAGGGTCCAAGG + Intergenic
906613819 1:47221661-47221683 CACTCTGAGGTCTGGTTCCAGGG - Intronic
906701979 1:47866250-47866272 CCCTTGGAAGTCATAGTCCAGGG + Intronic
907331849 1:53676744-53676766 CTCTTGGAGGTCAGGGTGGAGGG - Intronic
907391584 1:54161666-54161688 GCCCTGGAGGTCAGGGTCCTGGG - Intronic
908713403 1:67043456-67043478 CCCTTGGATTCCTGGGTTCAAGG - Intronic
913975607 1:143452166-143452188 CACTTGCAGGTGTTGGTCCAGGG - Intergenic
914070002 1:144277783-144277805 CACTTGCAGGTGTTGGTCCAGGG - Intergenic
914109153 1:144688571-144688593 CACTTGCAGGTGTTGGTCCAGGG + Intergenic
915121062 1:153629741-153629763 CCCTGGGAACTCTGGCTCCAAGG + Intronic
915527167 1:156483051-156483073 CTCTTGGAGCTCTGCGTCCCTGG - Intronic
916201264 1:162273562-162273584 ACCTTGGAGGCCTGGGGGCAAGG + Intronic
919261962 1:195208238-195208260 GCCTAGGAGGTCTGTGTCCAGGG + Intergenic
919782664 1:201230901-201230923 CCCTTGGAGGCCTGGGACAGTGG + Intergenic
920983528 1:210862224-210862246 CTCTTGCAGGGCTGGGTCCATGG + Intronic
923712680 1:236399729-236399751 GCTTTGAAGGTCTGGGTCAAAGG + Intronic
924043834 1:240008989-240009011 CCCTTGGAGGGCAGGGTGGAAGG + Intergenic
1063441633 10:6077734-6077756 CCCTGGGGGGTCTGTGTCCCTGG + Intergenic
1064993715 10:21278491-21278513 CCCTAGCAGTTATGGGTCCAGGG - Intergenic
1065513759 10:26505252-26505274 ACCTTGAAAGTCTGGCTCCAGGG - Intronic
1065524526 10:26605975-26605997 CTCTTTGAGGTCTGGGTTCTGGG - Intergenic
1065532290 10:26684259-26684281 CTCTTTGAGGTCTGGGTTCTGGG - Intergenic
1066415155 10:35214702-35214724 CCCATGCAGGTCTGGGAGCATGG - Intergenic
1067789287 10:49275646-49275668 TCCTGGGAGCTCTGGGTGCATGG + Intergenic
1070751608 10:78967247-78967269 CCTTTGAAGTTCTGGGTCCTAGG + Intergenic
1070829991 10:79412256-79412278 CCCTTGGGGTTCTGGAGCCATGG - Intronic
1073328479 10:102656265-102656287 CTCGTGCAGGTCTGGGTCCTGGG - Exonic
1075256273 10:120928130-120928152 CCTCTGGGGGTCTGGCTCCAGGG - Intergenic
1076063764 10:127432352-127432374 GCCTTGGAGGGCTGGAACCATGG + Intronic
1076365906 10:129920981-129921003 CCCTCGGTGGTCTGGGGACAGGG + Intronic
1076921518 10:133456922-133456944 CCCTTTGAGGTCTGGCTCGAGGG + Intergenic
1077211454 11:1372587-1372609 CCCATGGGGGTCTGGCTACAGGG + Intergenic
1077253005 11:1568881-1568903 CCCTGGGAGCTGTAGGTCCAGGG - Intronic
1077844575 11:6011734-6011756 CCCTTGGAGGTGTGGGATCCAGG - Intergenic
1080667438 11:34348231-34348253 TAATTGGAGGTCTGGGGCCATGG + Intronic
1083799142 11:65036163-65036185 CCAATGGAGGTCAGGGTCCTGGG + Intronic
1084473957 11:69378297-69378319 CCCATAGAGGTCTGGGCTCAGGG + Intergenic
1085735143 11:79032317-79032339 CCCTTCGAGGTCTACATCCAGGG - Intronic
1086167714 11:83798662-83798684 CAGTTGGGGGTCTGGGTGCAAGG + Intronic
1090977796 11:131691319-131691341 CCCCTGTGGGTCTGGGCCCAAGG + Intronic
1091098317 11:132845069-132845091 CCCTTGGTGGTGTGGGACCAAGG + Intronic
1092428451 12:8391429-8391451 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1092429534 12:8397581-8397603 CCCCTGCACGGCTGGGTCCAAGG - Intergenic
1094766241 12:33598065-33598087 TCCTCAGAGGTCTGGGTTCAAGG - Intergenic
1097339740 12:58423729-58423751 TCCTTGGAGGTCTGGATCTTAGG + Intergenic
1102444940 12:112994788-112994810 GCCCTGGAGGTCTGGGGACAGGG - Intronic
1103034368 12:117644504-117644526 CCCCTGGAGGATAGGGTCCAGGG - Intronic
1106394038 13:29363054-29363076 CACTTGGGGGTCTGGGAGCATGG - Intronic
1106487405 13:30184738-30184760 CCCTTGGAGGTAAGGGGGCAAGG - Intergenic
1107147190 13:37071200-37071222 CCCTTGGAGGTGTGGGATCCAGG + Intergenic
1107435328 13:40376438-40376460 CCCTTGGCTCTCTGGGGCCATGG - Intergenic
1108374285 13:49798816-49798838 AGCTTGGAGCTCTGGTTCCAAGG + Intergenic
1111306417 13:86418968-86418990 CCATTGGAAGCCTGAGTCCAAGG - Intergenic
1112124889 13:96454078-96454100 CCCTTGGCCTTCTGAGTCCAGGG + Intronic
1114720050 14:24871948-24871970 GCCATGGAGGTCTGGGCCCATGG - Intronic
1118994398 14:70822886-70822908 CCCTTGGTGGGCTGGGCTCAGGG + Intergenic
1119134275 14:72202719-72202741 CCCTTGGAGGGGAGGGTCCTGGG + Intronic
1119205505 14:72790957-72790979 CTCCTGGTGGTCTGGGTCAATGG + Intronic
1120542438 14:85766618-85766640 ACCTTGATGGTCTTGGTCCAAGG - Intergenic
1121854354 14:97253053-97253075 CACTTACAGGTCTGGGGCCAGGG + Intergenic
1123014568 14:105367658-105367680 CCCTTGCTGGTCTGGGTGCAGGG + Intronic
1124883263 15:33661250-33661272 CCCTTGTTTGTGTGGGTCCAGGG - Intronic
1126765483 15:52007205-52007227 CCCTTGGGGGTAAGTGTCCAAGG - Intronic
1129716839 15:77857232-77857254 CCCTTGCAGGCCTGGCTCCCAGG + Intergenic
1131168700 15:90161348-90161370 CTCTTGGCTGTCTGGGTTCATGG + Intronic
1131836859 15:96399486-96399508 TCCTCGGAGGTTTTGGTCCATGG - Intergenic
1134051482 16:11140807-11140829 ACCTGGGGGGTCTGGCTCCAGGG - Intronic
1135553495 16:23416447-23416469 GCCAGGGAGCTCTGGGTCCAAGG + Intronic
1137624596 16:49899851-49899873 CCCTGGGAGCACTGGGTCCTTGG + Intergenic
1138996677 16:62463087-62463109 CTCTTGGAAGTCTTGGTCCAGGG - Intergenic
1142004067 16:87680698-87680720 CCCTTGGAGAACTGGGTGCCAGG + Intronic
1142183139 16:88681389-88681411 CCCGTGCCGGTCTGGGCCCAAGG + Exonic
1142264728 16:89058464-89058486 CCCCTGGGGGCCTGGGTCCCAGG - Intergenic
1143392223 17:6566196-6566218 CACTTTCAGGTCTGGGTCAATGG - Intergenic
1143995955 17:11006575-11006597 CCCTTAGTGGGCTGGGTTCAGGG + Intergenic
1145259534 17:21346605-21346627 CCCTTGGGGTCCTGGGTCCCTGG - Intergenic
1145317083 17:21741343-21741365 CCCTTGGGGTCCTGGGTCCCTGG + Intergenic
1147119383 17:38326951-38326973 GACTTTGAGTTCTGGGTCCAGGG + Exonic
1148232632 17:45946162-45946184 CACTTGGGGCTCTGGGTTCAGGG + Intronic
1148703296 17:49605328-49605350 TCCTTGGGGGACTGGGTCCAGGG + Intronic
1149813107 17:59697079-59697101 CCCCTGGAGGTCGAGGTTCAAGG - Intronic
1150229880 17:63544068-63544090 CCCATGGAGTTCTGGCTCCCAGG - Exonic
1152072416 17:78140544-78140566 CCCTTGGAGGTCGTGGTCTCGGG + Intronic
1152717817 17:81908343-81908365 CCTTTGGAGCCCTGGGGCCATGG + Intronic
1152772950 17:82181317-82181339 TCCTTGGAGCTCTCGCTCCAGGG + Intronic
1153649716 18:7229330-7229352 CCCTGTGAGGTCAGGGTCCCAGG + Intergenic
1155998578 18:32358762-32358784 CACTAGGAGGTCAGGGTCAAAGG + Intronic
1156494434 18:37516706-37516728 CCCAGGCAGGTCTGGCTCCAAGG + Intronic
1157195958 18:45620212-45620234 CCCTTGAGCGCCTGGGTCCAGGG - Intronic
1158874886 18:61723955-61723977 CACCTGGATGTCTGGGCCCACGG + Intergenic
1159006283 18:63015790-63015812 CCCTGGGAGGTCTTGCTCCATGG - Intergenic
1160222582 18:76988256-76988278 GCCTTGCAGGGCTGGGTCCCCGG + Intronic
1160946836 19:1647638-1647660 CCCTTGGAGGTCTGGGTCCAGGG - Intronic
1161330205 19:3683300-3683322 TCCACGGAGATCTGGGTCCAGGG + Intronic
1163031967 19:14550589-14550611 CCCCTGGGGGTCTGGGACCTGGG + Intronic
1163128972 19:15260101-15260123 CCTCTGGAGGTCTGGGTCTGAGG + Intronic
1163731038 19:18949285-18949307 CCCTGAGAGGCCTGGGTCCTGGG - Intergenic
1164833570 19:31341351-31341373 CCTGTGGTGGTCTGGATCCAGGG + Intronic
1165143949 19:33719666-33719688 CCCCAGGCTGTCTGGGTCCAGGG + Intronic
1165287488 19:34853808-34853830 CCCAGGAAGGTGTGGGTCCATGG + Intergenic
1165806718 19:38584815-38584837 CCCTTTGAGGGCAGGGCCCAGGG + Intronic
1165978114 19:39694693-39694715 CCCATGGAGGGCTGGGTACTGGG - Intergenic
1166367879 19:42286404-42286426 CCCGTAGAGGTCTGGGGCCTTGG + Intronic
1166695538 19:44849394-44849416 CCCACGGAGGTCAGGGTACAGGG + Intronic
925223514 2:2162149-2162171 CCCATGGAGGTCTGCCTTCAGGG - Intronic
925309826 2:2874667-2874689 CCCAGTGAGGTCTAGGTCCAGGG + Intergenic
927076074 2:19579104-19579126 ACCTAGGAAGTCTGGCTCCAAGG + Intergenic
930490079 2:52058398-52058420 GGCTTGAAGGTCTAGGTCCATGG + Intergenic
934180308 2:89613138-89613160 CACTTGCAGGTGTTGGTCCAGGG - Intergenic
934290607 2:91687401-91687423 CACTTGCAGGTGTTGGTCCAGGG - Intergenic
934664058 2:96157912-96157934 CCCTTGGCGGACTGGGACTATGG - Intergenic
935439541 2:103076144-103076166 CCCTTGGATGTCTGGCTGCTAGG - Intergenic
935726588 2:106029063-106029085 GCCTTGGAGGCCTGCCTCCAAGG - Intergenic
936093344 2:109514786-109514808 CCCTTGGGGGTTTGGGTGCCAGG + Intergenic
936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG + Intergenic
937146944 2:119655701-119655723 CTCTTGGTGGGCTGGGGCCAAGG - Intronic
937382021 2:121387121-121387143 CCCATGGGGGTCTGTCTCCAAGG - Exonic
937839021 2:126507004-126507026 CCCCTGGAGGTGAGGGTTCATGG - Intergenic
937841458 2:126528351-126528373 CCCATGGAGTTCTAGGCCCAGGG - Intergenic
938927842 2:136060672-136060694 CCATGGGAGGTCTGGATTCAGGG + Intergenic
942454388 2:176128388-176128410 GCCTTGGAGGTCTATTTCCAAGG + Intergenic
942564724 2:177255106-177255128 CTCTTGGAAGTCTGGGTCCCCGG - Intronic
944863108 2:203834289-203834311 TCCTCGGAGGTCTGGGTCCCAGG - Intergenic
945186878 2:207148308-207148330 CTCATGGAAGTCTGGGGCCAGGG + Intronic
947915839 2:233831118-233831140 CCCATGGAGGGCTGGGTCCCAGG + Intronic
948793606 2:240391438-240391460 CCCTGGGGGGTCTGTGTCCAGGG - Intergenic
948830303 2:240595355-240595377 CCCATGGAGGTCTGGGTTCTAGG + Intronic
948835718 2:240625117-240625139 CCCTGGGAGGGCTGGGCCCTGGG + Intronic
948850724 2:240704122-240704144 CTGCTGGAGGTCTGGGGCCAAGG - Intergenic
1169258067 20:4113799-4113821 CCCTGTGAGGTCTGGGCCAAGGG - Intergenic
1172099262 20:32475554-32475576 CCCCTGGAGGGCTGGGTTGAAGG - Intronic
1172482258 20:35277948-35277970 CCCTTTAAGGTCTGGGTCGCCGG + Intergenic
1175197394 20:57253818-57253840 CCCTGGGAGGACTGGGTGAAGGG - Intronic
1175251925 20:57615138-57615160 GCCTTGAGGGGCTGGGTCCAGGG - Intronic
1175261701 20:57678642-57678664 CACTTGCAGGTCTGGCTCCCAGG + Intronic
1175286879 20:57842491-57842513 TCCTGGGAGGTTTGGGACCAAGG + Intergenic
1176150623 20:63589009-63589031 CCCTTGGTGGTCTCTGTCCAAGG - Exonic
1176261379 20:64182659-64182681 GCCAGGGAGGGCTGGGTCCAGGG - Intronic
1178910175 21:36667763-36667785 CCCATTGAGGGCTGGGTGCATGG + Intergenic
1179983323 21:44907576-44907598 GCCTGGGAGGCCTGGGCCCAGGG + Intronic
1180801394 22:18633799-18633821 CCCTGGCAGGGCTGGGTCCCGGG - Intergenic
1181220327 22:21361462-21361484 CCCTGGCAGGGCTGGGTCCCGGG + Intergenic
1181479822 22:23191676-23191698 CCCATGGAGGTCTGTGTCTCGGG + Intronic
1182458183 22:30465893-30465915 CCCTCACAGGCCTGGGTCCATGG - Intronic
1183547242 22:38461022-38461044 CCCTTCGAGAAGTGGGTCCAGGG - Intergenic
1184712325 22:46259581-46259603 TCGTTGGGGGTCTGGGACCAGGG - Exonic
1185242705 22:49755163-49755185 CCCTGGGAGGACAGGGTCCCTGG + Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185423374 22:50748218-50748240 CCCTTAGATGTCTAGGTCCCTGG - Intergenic
954645823 3:52130972-52130994 CCTGTGCAGGTCTGGGTCCAGGG + Intronic
954646980 3:52137612-52137634 CCCTGGGTGGGCTGGGTCCCTGG - Intronic
956390825 3:68771065-68771087 CCCTGGGTGGCCTGTGTCCAGGG + Intronic
956715724 3:72078221-72078243 ACCTTGGAAGCCTGGGGCCAGGG + Intergenic
956879142 3:73492500-73492522 TCATTGGATGTCTGGGTGCATGG + Intronic
957035144 3:75287513-75287535 CTCTTGGATCCCTGGGTCCATGG + Intergenic
958862780 3:99465639-99465661 CCCTAAGAGATCTGGGTCCATGG + Intergenic
960131147 3:114057182-114057204 CCTAGGGAGGTCTGGGGCCATGG + Intronic
960333986 3:116393515-116393537 CCCTTGGAGGTGTGGGACCCAGG + Intronic
961007256 3:123413350-123413372 CCCTGGGTGGGCTGGGCCCAAGG + Intronic
961321911 3:126082690-126082712 CGCCTAGAGGCCTGGGTCCAAGG - Intronic
961572054 3:127806259-127806281 CCCTTGGAAGGCAGGGACCATGG + Intronic
961818962 3:129565576-129565598 CCCTAGGAGCTGTGGGTCCCAGG + Intronic
963454130 3:145522302-145522324 CCCTTGGAGGCATGGGACCCAGG - Intergenic
963732082 3:148984634-148984656 CCCTTGGAGCTCTGGATGCTGGG - Intergenic
963990861 3:151652160-151652182 ACCTAGGATGCCTGGGTCCAAGG - Intergenic
964656860 3:159076790-159076812 GCCTAGGAAGTTTGGGTCCAGGG - Intronic
966810146 3:183836628-183836650 ACCTAAGAGGTGTGGGTCCATGG + Intronic
967151860 3:186658471-186658493 GCATTGGAGTTTTGGGTCCATGG - Intergenic
973627998 4:52791754-52791776 CCCTAGGAGGTCTGGGTCCATGG - Intergenic
974260148 4:59517130-59517152 CCCTTGGAGGTGTGGGATCCAGG - Intergenic
976455019 4:85236462-85236484 TCCTTGGAGGGCTGAGACCATGG + Intergenic
976567831 4:86572477-86572499 CCCTTGGAATTCTGTGTTCATGG + Intronic
978229990 4:106386211-106386233 CCCTTGGAGGTGTGGGATCAAGG + Intergenic
985578929 5:686520-686542 CCCTCGGGGCTCCGGGTCCAGGG + Intronic
985593775 5:778583-778605 CCCTTGGGGCTCAGGGTCCAGGG + Intergenic
987167342 5:15214529-15214551 ACCTGGGAGGTCTGAGTCCAAGG + Intergenic
987753393 5:22069332-22069354 CCCTTGCAGGGCTGGGGCAAGGG + Intronic
989016179 5:36937459-36937481 CCGTTGGAGATCTGTGTGCATGG + Intronic
991142455 5:63260489-63260511 CCCTTGTATCTCTGGGTCCCAGG - Intergenic
992473026 5:77076853-77076875 CACTGGGTGGTCTGGGTTCACGG + Exonic
995012596 5:107274632-107274654 ACCTTGGGGCTCTGGTTCCATGG - Intergenic
998153775 5:139772388-139772410 CACTTAGAGGTCTCGGTTCATGG + Intergenic
1001106496 5:168858876-168858898 CCCTGGGCGGGCTGGGTGCAGGG + Intronic
1001331754 5:170767144-170767166 GCCCTGGAGTTTTGGGTCCATGG + Intronic
1002986362 6:2192799-2192821 CCCTTGGAGGTGTGGGATCCAGG + Intronic
1005880615 6:30056571-30056593 ACCTTGGAGGGCTGGGAACAGGG + Intergenic
1011215515 6:85001515-85001537 CTCTTTGAGGTCTGAATCCATGG - Intergenic
1013398345 6:109766829-109766851 TCTTTGGAGTGCTGGGTCCATGG - Exonic
1013579632 6:111520284-111520306 ACCTTGGATGTATGGGACCATGG + Intergenic
1014295951 6:119618408-119618430 ACCTCGGAGGTCAGGGTCCAGGG + Intergenic
1014909599 6:127075251-127075273 CCCTTGCAGGGCTGGCTTCATGG - Intergenic
1016892607 6:149021510-149021532 CCATGAGAGGTCTGTGTCCAGGG + Intronic
1017054638 6:150425822-150425844 CCCTTGGAGGTGTGGGATCCAGG + Intergenic
1018669554 6:166167694-166167716 CCGTCGCAGGTCTCGGTCCAAGG - Exonic
1021031296 7:15739621-15739643 CCTTTGAAGGTCAGGGACCAAGG + Intergenic
1021957272 7:25838673-25838695 CTTTTGGAGGTCTGGGTAAATGG - Intergenic
1022025547 7:26444613-26444635 CCCTTGGATGTCTAGGACCAGGG + Intergenic
1022785802 7:33635453-33635475 GCCTTGGGGGGCTGGTTCCAGGG - Intergenic
1023226455 7:37974650-37974672 CCCTTGGAGGCCAGTGTCCTTGG - Intronic
1026582508 7:71630087-71630109 CCCCTGGATGTCTGGATCCCAGG - Intronic
1029306788 7:99625487-99625509 TCCTGGGAGACCTGGGTCCAGGG + Intronic
1029503748 7:100949795-100949817 CGCTTGGGGCTCTGGGTGCAGGG + Intronic
1035169100 7:157008193-157008215 CCCTAGGAGGCCTAGGACCACGG + Intronic
1035731159 8:1854266-1854288 CCCTTGGAGGTGGGGGTCAGAGG + Intronic
1037022320 8:13988915-13988937 CACTTGGAGTTCTGGGTGCAAGG - Intergenic
1038594436 8:28874221-28874243 CCTTTGGAAATCTGGGACCAAGG - Intronic
1043883275 8:85569046-85569068 ACTTTGGAGCCCTGGGTCCAAGG - Intergenic
1044148753 8:88747101-88747123 GCGTTGGAGTTTTGGGTCCACGG + Intergenic
1047509568 8:125505994-125506016 CCCTTGCAGTTTAGGGTCCAGGG - Intergenic
1049475221 8:142794183-142794205 CCGAGGGAGGTCTGGGTCCAGGG - Intergenic
1056773390 9:89495738-89495760 ACCCTGGAGCTCTGGCTCCAGGG + Intronic
1059401369 9:114072446-114072468 CCCTTGGAGGTGTGGGATCCAGG + Intronic
1059687678 9:116653094-116653116 CTCTTGGAGATCAGGGGCCATGG + Intronic
1061189049 9:129071167-129071189 CCCAGGGAGGTCTGGGCTCATGG - Exonic
1061714321 9:132509433-132509455 TCCTTGGAGATCCAGGTCCATGG - Intronic
1061898998 9:133663396-133663418 CACATGGAGGCCTGGGACCAAGG - Intergenic
1062360678 9:136186548-136186570 CCCTCGGGGGGCTCGGTCCAGGG - Intergenic
1062645809 9:137547545-137547567 CCCATCCAGGTCTGGCTCCAGGG + Intronic
1185626219 X:1484178-1484200 TCATTGGGGGTTTGGGTCCAGGG - Intronic
1187035001 X:15529141-15529163 AGCTTGGAGGTCTGGGTTCTAGG - Intronic
1189238367 X:39506357-39506379 CCCTTGGAGATCTCTGTTCATGG + Intergenic
1189269358 X:39740112-39740134 GAGTTGGAGGTCTGGGCCCAGGG + Intergenic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic
1195755814 X:108197667-108197689 CCCTTGGCTTTCTGGGCCCAGGG + Intronic
1196677319 X:118433505-118433527 ACCTTGGGAGTCTGGCTCCAGGG - Intronic
1198961157 X:142184977-142184999 GCGTTGGAGGTCTGGGTGCATGG + Intergenic
1200883658 Y:8246340-8246362 CCCTTGGAGGCATGGTTCCTAGG - Intergenic
1201931466 Y:19354203-19354225 CCCTTGTAGGTCCCAGTCCAAGG - Intergenic