ID: 1160947199

View in Genome Browser
Species Human (GRCh38)
Location 19:1649135-1649157
Sequence CGGAGCAGGCAGGCCCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160947199_1160947210 24 Left 1160947199 19:1649135-1649157 CCCCACCGGGCCTGCCTGCTCCG 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1160947210 19:1649182-1649204 TGGTGGCGCTGCTGTCTGCTCGG 0: 1
1: 0
2: 0
3: 21
4: 218
1160947199_1160947207 4 Left 1160947199 19:1649135-1649157 CCCCACCGGGCCTGCCTGCTCCG 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1160947207 19:1649162-1649184 GATAACCGTGGCAGTCACAATGG 0: 1
1: 0
2: 0
3: 4
4: 73
1160947199_1160947208 7 Left 1160947199 19:1649135-1649157 CCCCACCGGGCCTGCCTGCTCCG 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1160947208 19:1649165-1649187 AACCGTGGCAGTCACAATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 68
1160947199_1160947211 27 Left 1160947199 19:1649135-1649157 CCCCACCGGGCCTGCCTGCTCCG 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1160947211 19:1649185-1649207 TGGCGCTGCTGTCTGCTCGGTGG 0: 1
1: 0
2: 0
3: 14
4: 144
1160947199_1160947205 -8 Left 1160947199 19:1649135-1649157 CCCCACCGGGCCTGCCTGCTCCG 0: 1
1: 0
2: 1
3: 32
4: 296
Right 1160947205 19:1649150-1649172 CTGCTCCGCAGTGATAACCGTGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160947199 Original CRISPR CGGAGCAGGCAGGCCCGGTG GGG (reversed) Intronic
900100251 1:959420-959442 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
900124855 1:1064791-1064813 CGGGGCAGGGTGGCCAGGTGCGG + Intergenic
900515924 1:3082229-3082251 CTGTGCAGTCAGGCCCTGTGTGG + Intronic
900548608 1:3242287-3242309 CGAAGCAGGCAGGACTGGGGAGG + Intronic
900639947 1:3683911-3683933 GGGGGCAGGCAGGGCCAGTGAGG + Intronic
901052593 1:6432717-6432739 GGGAGCAGCCAGGCTCTGTGAGG + Intronic
901129522 1:6953556-6953578 AGGAGCAGGCAGGCTCCCTGCGG - Intronic
901431975 1:9221925-9221947 TGGAGCAAGCAGGCCAGGTGAGG - Intergenic
901644651 1:10709919-10709941 CGGACCAGGGAGGGGCGGTGGGG + Intronic
901646910 1:10721743-10721765 CGGATCTGGCAGGCCTGGGGAGG + Intronic
901705663 1:11071186-11071208 AGGAGCAGGCAGGGCTGGGGAGG - Intronic
901765454 1:11497008-11497030 CTGAGAAGGCAGGCACGGGGTGG + Intronic
901831262 1:11894046-11894068 AGGAGCAGGCTGACCAGGTGTGG - Intergenic
901882512 1:12202450-12202472 AGGAGCAGCCAGGCCAGCTGGGG - Intronic
902231392 1:15029878-15029900 CGGAGCAGGAGGGCCCAGTGAGG + Intronic
902261315 1:15226880-15226902 TGGAGCAGGCTGGCCAGGAGAGG + Intergenic
903655711 1:24947796-24947818 CGGAGCTGGCAGGGCCTGAGTGG + Intronic
903830519 1:26171490-26171512 CTGAGCAGGCAGGCCCAGATGGG - Exonic
903927208 1:26839087-26839109 AGGAGCAGGCAGGCCTTCTGCGG - Intronic
904134229 1:28298798-28298820 AAGAGAAGGCAGGCCGGGTGCGG + Intergenic
904507284 1:30968348-30968370 GGCAGCAGGCATGCCAGGTGCGG - Exonic
904826457 1:33276609-33276631 CGGGGCCGGCGGGGCCGGTGAGG + Intronic
904892879 1:33792548-33792570 AGGAGCAGGCAGGGGCTGTGAGG + Intronic
905106508 1:35566240-35566262 TGGGGCAGACAGGCCTGGTGGGG + Exonic
905214564 1:36397729-36397751 CGGTGCAGGGAGCCCCGGGGCGG - Intronic
905995862 1:42380496-42380518 CGGAGCAGGAGGGGCCGGGGCGG - Intergenic
906167292 1:43696212-43696234 CAGAGAAGGCAGGGCTGGTGTGG + Intronic
906816358 1:48883999-48884021 AGGAGCAGGAAGGCCCTCTGAGG - Intronic
908472993 1:64462573-64462595 TAAAGCAGGCAGGCCAGGTGTGG - Intergenic
910931124 1:92443447-92443469 CAGAGGAGGCAGGCCGGGTGCGG + Intergenic
912793359 1:112674742-112674764 CGGAGGAGGGAAGCCTGGTGGGG + Intronic
913047933 1:115089514-115089536 CGGAGCGGGGAGGACCGGGGCGG + Intergenic
913671051 1:121097652-121097674 GAGAGCAGGCGGGCCCGGGGCGG - Intergenic
913990719 1:143609300-143609322 GGGGGCAGGCAGGCCCCATGGGG - Intergenic
914022814 1:143885073-143885095 GGGAGCAGGCGGGCCCGGGGCGG - Intergenic
914661301 1:149793017-149793039 GGGAGCTGGCGGGCCCGGGGCGG - Intronic
914873091 1:151491804-151491826 GAGAACAGGAAGGCCCGGTGTGG - Intergenic
914929630 1:151919468-151919490 AGGAGCAATCAGGCCGGGTGCGG + Intergenic
915901367 1:159848792-159848814 AGGAGCACACAGGCCGGGTGCGG + Intronic
915949602 1:160179987-160180009 GGGAGCAAGCAGCCCAGGTGGGG + Intronic
920563254 1:206954278-206954300 GGGAGCAGGCTGGCCCGGGAAGG + Intergenic
920971736 1:210748902-210748924 GGGAGCAGGTAGGACAGGTGGGG - Intronic
921059964 1:211577858-211577880 GGGAGCAGGCAGGGGCGGCGCGG + Intronic
922166153 1:223117211-223117233 CGGAGCAGCCAGGGGCAGTGAGG - Intronic
922322886 1:224503509-224503531 CGGCTCTGGGAGGCCCGGTGGGG - Intronic
924436588 1:244048649-244048671 CGGAGCCGCCGGGCCGGGTGGGG - Intergenic
924586823 1:245367520-245367542 CAAAGCAGGCAGGCCCGGGTGGG - Intronic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1065099893 10:22321859-22321881 CGGGGCCGGCAGGCGCGGGGCGG - Intronic
1065342949 10:24723585-24723607 CGGAGCCGGCCAGCCCCGTGCGG - Exonic
1066649211 10:37639413-37639435 AGGAGGGGGCAGGCCAGGTGTGG - Intergenic
1068735577 10:60410136-60410158 AGTAGTAGGCAGGCCAGGTGTGG + Intronic
1070397313 10:76022678-76022700 TGGAGCAGTGAGGCCTGGTGGGG - Intronic
1072903565 10:99430604-99430626 CGGAGCTGGCAGGTCAGGTCTGG + Intronic
1073323134 10:102627779-102627801 AGGAGCTGGCAGGCCAGCTGTGG + Intronic
1075407944 10:122207006-122207028 GGGAGCAGGGAGGCTGGGTGTGG + Intronic
1075979199 10:126722478-126722500 CGGAGAAGGGAAGCCCTGTGGGG - Intergenic
1076282838 10:129264083-129264105 CTGAGCTGGAAGGCCCCGTGGGG - Intergenic
1076434825 10:130433141-130433163 CAGAGCAGGCGGGCCAGGAGAGG + Intergenic
1077139164 11:1016005-1016027 AGGAGAAGGCAGGGGCGGTGTGG + Exonic
1077353253 11:2102756-2102778 GGGAGCAGGAAGTCCGGGTGGGG + Intergenic
1078667881 11:13341183-13341205 CAGAGCAGGCTGGCCAGGCGTGG - Intronic
1081694952 11:45103222-45103244 GGGAGGAGGCAGGCCCGGCGGGG - Intronic
1081850806 11:46274058-46274080 CTCAGCAGGCAGGCCCTGGGTGG - Intergenic
1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG + Intergenic
1082795739 11:57376652-57376674 CCGAGTAGGGCGGCCCGGTGGGG - Intergenic
1083628433 11:64083830-64083852 CGGATCTGCCAGGGCCGGTGAGG + Intronic
1083642751 11:64154201-64154223 GAGAGCAGGCAGGCACTGTGGGG - Intronic
1083880733 11:65547055-65547077 CCGAGCATACAGGCCGGGTGCGG + Intronic
1084096796 11:66916662-66916684 GGGAGCAGAAAGGCCGGGTGTGG + Intronic
1084129268 11:67120196-67120218 TGGAGCAGCCAGGGCCGGAGAGG - Intronic
1084615017 11:70229966-70229988 AGGAGCCGGCAGGCCGGGCGTGG + Intergenic
1084643047 11:70437266-70437288 CCCAGCAGACAGGCCCTGTGTGG - Intergenic
1084890597 11:72235090-72235112 GGAAGCAGGGAGGCCCAGTGAGG - Intronic
1085297562 11:75439602-75439624 ATGAGCAGGCCAGCCCGGTGAGG + Intronic
1088750706 11:112839941-112839963 CAGATCAGGCAGGCCCGAGGAGG + Intergenic
1089012947 11:115145431-115145453 TGGAGCAGGCATGCCCGCTGGGG - Intergenic
1089697628 11:120225803-120225825 TGGGCCAGGCAGGCCTGGTGGGG - Intronic
1090058207 11:123441345-123441367 CTCAGCATGCAGGCCGGGTGTGG + Intergenic
1090464689 11:126923732-126923754 AGAAGTAGGCAGGCCAGGTGCGG - Intronic
1090663119 11:128895680-128895702 GAGGGCAGGCAGGCCCGGTGTGG - Intronic
1090887855 11:130895093-130895115 CAGAGAGGGCAGGCTCGGTGGGG + Intronic
1090905316 11:131069319-131069341 GGGAGCAGGCAGGCCTGGGCAGG - Intergenic
1091644450 12:2263239-2263261 GGGAGCAGGAGGGCCAGGTGCGG + Intronic
1091644466 12:2263295-2263317 GGGAGCAGGAGGGCCAGGTGCGG + Intronic
1092615587 12:10213081-10213103 CGAAGGAGGCAGGCCCCGCGCGG + Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096403248 12:51324275-51324297 TGGAGCAGGCCGGCTCGGAGGGG + Intronic
1101923758 12:108954432-108954454 GGGAGCAGGCAGGCAAGCTGGGG + Intronic
1103607497 12:122098046-122098068 AGGAGCTGGCAGGGCCTGTGTGG + Intronic
1104944288 12:132408791-132408813 GGGAGCAGGCAGGGCCTGGGAGG + Intergenic
1105930494 13:25047509-25047531 CGGGGCAGGCAGACCTGGGGTGG + Intergenic
1106131980 13:26948460-26948482 GGGTGGACGCAGGCCCGGTGAGG - Intergenic
1106717461 13:32406197-32406219 TGGGGCAGGAAGGCCGGGTGCGG - Intronic
1112290861 13:98143268-98143290 CGGAGCAGGCGGGGTGGGTGGGG - Intronic
1112677712 13:101722752-101722774 CGGAGCAGGAATGTCTGGTGAGG + Exonic
1112968541 13:105230042-105230064 AGGAGCAGGCAGGCCAGGCACGG - Intergenic
1113042504 13:106120166-106120188 AGGAGCAGGCAGGCCAGGCGGGG - Intergenic
1117249086 14:53917390-53917412 CGGATCAAGCAGGCCAGCTGAGG - Intergenic
1119650772 14:76381324-76381346 GGAGGCAGGCTGGCCCGGTGAGG - Intronic
1120993362 14:90397563-90397585 CGCTGCAGGCAGCCCGGGTGCGG - Intronic
1121791749 14:96704354-96704376 AGGAGCAGGCAGGCCTCCTGGGG + Intergenic
1122693770 14:103543230-103543252 TGGCCCAGGCAGGCCCTGTGAGG + Intergenic
1122955662 14:105069755-105069777 CTGAGCAGGGGGGCCCGGCGAGG - Intergenic
1123006194 14:105324988-105325010 CGGAACAGCCAGGCCCAGAGCGG - Intronic
1124036566 15:26058371-26058393 CGGAACAGGCAGGCCTGAAGAGG - Intergenic
1124973617 15:34514343-34514365 CGGAGCAGGCTGGCCGACTGAGG + Intergenic
1125181035 15:36880871-36880893 CTGAGCAGACAGACCCGGTGAGG - Intergenic
1126142287 15:45448420-45448442 CCCAGCAGGCAGGCTCTGTGGGG - Intronic
1126342115 15:47652459-47652481 CGGAGCGGGCAGGCGGGGTGAGG - Intronic
1128322596 15:66703581-66703603 CGGAGCCGGGAGGCCCGGGCTGG + Exonic
1129152328 15:73696885-73696907 AGGAGCAAGCAGGGCCAGTGAGG + Intronic
1129217240 15:74107375-74107397 CCCAGCAGGCTGGCCCAGTGTGG + Intronic
1129668785 15:77595478-77595500 GGGAGCAGCCAGGCCGGCTGGGG - Intergenic
1129744397 15:78007992-78008014 GTGAGCAGGCAGGCCAGGCGGGG + Intronic
1129803931 15:78438484-78438506 CCCAGCAGGCAGGCCCCGAGGGG - Intronic
1131097978 15:89667774-89667796 CAGAGCAGCCTGGCCCAGTGGGG - Exonic
1131195096 15:90349224-90349246 CGAAGGAGGCAGGCCCTGCGCGG - Intergenic
1131376897 15:91932385-91932407 CGGAGAAGGGAGGCCAGGTAGGG - Intronic
1132285339 15:100658485-100658507 AGGAGATGGCAGGCCCTGTGTGG - Intergenic
1132630365 16:914364-914386 CAGAGCAGGAAGGTCGGGTGTGG - Intronic
1133126848 16:3652732-3652754 AGCAGAAGGCAGGCCCAGTGGGG - Intronic
1136451179 16:30355093-30355115 CGGAGCAGGGAGGAACGGGGTGG - Intronic
1136713366 16:32258194-32258216 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136754545 16:32671237-32671259 TGGGGCAGGCAGGCAGGGTGGGG + Intergenic
1136813567 16:33199127-33199149 TGGGGCAGGCAGGCAGGGTGGGG - Intronic
1136820043 16:33309207-33309229 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136826607 16:33365747-33365769 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1136831673 16:33464518-33464540 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1137272032 16:46908243-46908265 TGGAGCCTGCAGTCCCGGTGGGG + Intronic
1137614749 16:49839488-49839510 CACAGCAGGCAGGCCCAGGGAGG + Intronic
1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG + Intronic
1138537329 16:57666977-57666999 AGGAGAAGGCTGGCCAGGTGTGG + Intergenic
1139513743 16:67441446-67441468 AGAACCAGTCAGGCCCGGTGAGG + Intronic
1139631058 16:68232164-68232186 GGGAGCAGGCAGGCAAGGGGTGG + Intronic
1140457534 16:75113880-75113902 GGGAGATGGCAGGCCAGGTGAGG + Intronic
1140480705 16:75261451-75261473 CGGGGCAGGCAGGGCCTCTGAGG - Intronic
1141595181 16:85092965-85092987 CGCAGAAGGCAGGCCCCCTGAGG - Exonic
1141635169 16:85310668-85310690 GGGAGCAGGAGGGCCCGCTGGGG + Intergenic
1141694789 16:85614178-85614200 CGGAGCAGGAAGGGCCGGGGAGG - Intronic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1142154858 16:88528284-88528306 AGGAGCAGGCAGGGCAGGAGAGG + Intronic
1202992144 16_KI270728v1_random:22102-22124 TGGGGCAGGCAGGCAGGGTGGGG - Intergenic
1203056692 16_KI270728v1_random:931568-931590 TGGGGCAGGCAGGCAGGGTGGGG + Intergenic
1142764794 17:2058975-2058997 CGAAGCAGTGAGGCCAGGTGAGG - Exonic
1143378679 17:6482229-6482251 CTGAGCAGACAGGCCCTGTTGGG + Intronic
1143635713 17:8162835-8162857 CGGCGCAGGGAAGCGCGGTGAGG + Intronic
1143998528 17:11031000-11031022 GTGAGCAGCCAGGCCGGGTGCGG - Intergenic
1144057339 17:11554824-11554846 GGGGGCATGCAGGGCCGGTGAGG - Intronic
1144207402 17:12988786-12988808 CTAAGCAGGCAGGCCGGGCGTGG + Intronic
1144725983 17:17503028-17503050 TGCAACAGGCAGGCCTGGTGAGG - Intergenic
1144753100 17:17663590-17663612 AGGAGCAGCCTGGCCCAGTGCGG + Intergenic
1146439006 17:32877198-32877220 CGGAGCCGGGAGGCCCGGGCGGG - Intergenic
1146692020 17:34883301-34883323 CCGAGAAGCCAGCCCCGGTGGGG + Intergenic
1146789545 17:35743564-35743586 CTCAGCAGGCAAGCCCTGTGGGG - Intronic
1147135052 17:38429371-38429393 AGGAGCAGGGAGGCCTGCTGGGG - Intronic
1147503863 17:40994043-40994065 TGGTGGTGGCAGGCCCGGTGGGG + Exonic
1147697985 17:42370897-42370919 CTTAACAGGGAGGCCCGGTGTGG - Intronic
1147731842 17:42609139-42609161 GGGTGCAGGCAGCCCTGGTGTGG - Exonic
1147755207 17:42762897-42762919 GGGAGGAGGGAGGCCTGGTGGGG - Exonic
1148261985 17:46192651-46192673 CGCAGCAGGGAAGCCCGGAGAGG + Exonic
1148490980 17:48023937-48023959 CGGAGCCGGCGGGCGCGGAGGGG - Intergenic
1148563556 17:48620046-48620068 CGCATCAGGCAGGCCCGGACAGG - Intronic
1151325571 17:73377900-73377922 AACAGCAGGCAGGCCGGGTGCGG - Intronic
1151557146 17:74852270-74852292 CGGCGCAGGCCGGTCTGGTGGGG - Exonic
1151967693 17:77439964-77439986 CTGAGCAGGCAGGGCCTGTGAGG + Intronic
1152381158 17:79942888-79942910 CGTTGCTGGCAGGCCCCGTGAGG - Intronic
1152699285 17:81811139-81811161 GGCGGCAGGCAGGCGCGGTGGGG + Intronic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1153329878 18:3862883-3862905 CGGGGCAGGGAGGCCCAGTGAGG - Intronic
1153836360 18:8967912-8967934 CGGAGCGAGCAGGCTGGGTGCGG + Intergenic
1160367831 18:78343898-78343920 CTGAGCAGACAGGCCCTGTTGGG + Intergenic
1160418535 18:78728349-78728371 CTGAGCAGACAGGCCCTGCGAGG + Intergenic
1160425895 18:78778873-78778895 CGCAGCAGGCAGGCACCGGGTGG + Intergenic
1160528927 18:79552474-79552496 TGGAGCAGGGAGGCCCGTGGTGG - Intergenic
1160875346 19:1294134-1294156 GGGAGGAGGCAGGAGCGGTGTGG + Intronic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1161479711 19:4504432-4504454 AGGAGCCTGCAGGCCCGGCGCGG - Exonic
1161491811 19:4566537-4566559 CTGAGCAGGCAGGCGCCGAGCGG - Intergenic
1161917024 19:7236250-7236272 AGGAGTGGGCAGGCCAGGTGCGG - Intronic
1162788673 19:13051919-13051941 CGGAGAAGGCGGGCGCTGTGAGG - Intronic
1164144739 19:22505082-22505104 GAGAGCAGGCAGGCTCAGTGTGG + Intronic
1165074930 19:33275422-33275444 TGGAGAAGGCAGCCCCTGTGGGG - Intergenic
1165321945 19:35091003-35091025 CGGAGCAGGCAGGGCGGCCGCGG - Intergenic
1165743550 19:38217437-38217459 GTGAGCTGGCAGGCCAGGTGGGG - Intronic
1165944893 19:39436092-39436114 CAGAGCGGGCGGGCCCTGTGAGG + Intergenic
1166046951 19:40235414-40235436 CGGAGCAGGCAGGCCCTGTATGG + Intronic
1166167891 19:41005155-41005177 GTGAGCAGACAGGCCAGGTGGGG + Intronic
1167125491 19:47545699-47545721 CGGCGCAGGAGGTCCCGGTGGGG + Exonic
926693556 2:15754472-15754494 CTGGGCAGGCTGGCCCAGTGGGG - Intergenic
928428685 2:31200293-31200315 CAGAGCAGCAAGGCCAGGTGCGG - Intronic
929564361 2:42975351-42975373 TGGAGCAGGGAGGCCCCGTGAGG - Intergenic
934884414 2:98012056-98012078 AGGAGCAGGAAGGCCAGGCGCGG + Intergenic
938079681 2:128363067-128363089 CGGGGAAGGCAGGAGCGGTGCGG + Intergenic
938247695 2:129791784-129791806 CGGAGGAGCCAGACCCGGTGAGG + Intergenic
938302955 2:130229177-130229199 CGGTGCGGGCAGCCCCGGTGGGG - Intergenic
938453711 2:131445045-131445067 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
940175194 2:150870745-150870767 AGGAGCAGGCACTCCAGGTGGGG + Intergenic
940612290 2:156006783-156006805 CTGAGCCTGCAGGCCCGGGGTGG + Intergenic
947220155 2:227784031-227784053 CTGAGTGGACAGGCCCGGTGCGG - Intergenic
947713999 2:232330860-232330882 CAGAGCAGGCAGGAACGGTGGGG - Intronic
947716125 2:232339687-232339709 CTGAGCATGCAGGGCCGGGGTGG + Intronic
947733207 2:232442240-232442262 CAGAGCAGGCAGGAACGGTGGGG - Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948505702 2:238426032-238426054 CAGACCTGGCAGGCCCTGTGGGG - Intergenic
948886396 2:240887266-240887288 CGGGGCAGGAAGGCCCGGCATGG - Intronic
948897873 2:240935572-240935594 AGGAGCAGGTGGGCCAGGTGAGG + Intronic
1168778171 20:465700-465722 AGGAGCAGATAGGCCGGGTGCGG - Intergenic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1171450236 20:25230650-25230672 AGCAACAGGCAGGCCAGGTGCGG + Intergenic
1172118326 20:32584207-32584229 CGGGACAGGCAGCCCCGGGGCGG + Intronic
1172409347 20:34710132-34710154 TGGAGAAGGCGGGCCAGGTGCGG + Exonic
1174165365 20:48580215-48580237 AGGAGCATCCAGGCCCGGGGAGG - Intergenic
1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG + Intergenic
1175358526 20:58389165-58389187 CGCAGCAGGCTGGCCCGCTCTGG - Exonic
1175403793 20:58714686-58714708 GGGAGCAGCCAGGGCCAGTGGGG - Intronic
1175429663 20:58892099-58892121 CTGAGCGGGCAGGCCGGGGGAGG - Intronic
1175920304 20:62447573-62447595 CAGAGCAGGCAGGACCGGCTGGG - Intergenic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176388517 21:6151552-6151574 CGGATCAGGAAAGCCCTGTGGGG + Intergenic
1176790244 21:13311321-13311343 TGGAGCAGGGAGGCGCGGTTGGG - Intergenic
1179279985 21:39925783-39925805 AGGAGCAGGGTGGCCCTGTGAGG - Intronic
1179314544 21:40230931-40230953 CAGAGCAGGGATGCCGGGTGGGG - Intronic
1179531916 21:42025535-42025557 CAGAGCAGGCCAGCCCTGTGTGG - Intergenic
1179734955 21:43386696-43386718 CGGATCAGGAAAGCCCTGTGGGG - Intergenic
1179979618 21:44889242-44889264 CGGAGCAGGCAGGGCGGGCAGGG - Intronic
1180952843 22:19728486-19728508 AGGAACATGCAGGCCCCGTGTGG - Intergenic
1181030690 22:20147734-20147756 GGGTGCAGGCAGCCCCAGTGGGG - Exonic
1181553911 22:23656503-23656525 AGGAGAAGGGAGGCCCAGTGTGG + Intergenic
1182422296 22:30254411-30254433 CTGAGCAGCCAGGCCCAGGGGGG + Intergenic
1182466418 22:30519713-30519735 AGGAGCAGGCAGGCTGGGTGTGG - Intergenic
1182854174 22:33502445-33502467 CGGAGCAGGCATGCAGGGAGCGG + Intronic
1183347386 22:37315389-37315411 CGGAGGTGGAGGGCCCGGTGGGG - Intergenic
1183396110 22:37571789-37571811 CGGAATAGGCAGGGCGGGTGGGG - Intronic
1183437733 22:37805060-37805082 GGGAGCAGGAAGGCCCGGGCCGG + Intergenic
1183545912 22:38454880-38454902 CGGAGCGGGCGGGGCCGGAGCGG + Intronic
1184108721 22:42383228-42383250 TGGGGGAGGCAGGCCCAGTGAGG + Exonic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184739548 22:46419500-46419522 TGGAGGAGGCAGGCCCCGGGAGG - Intronic
1185109008 22:48890454-48890476 TCGAGCTGGCAGGCCGGGTGGGG + Intergenic
1185222598 22:49636480-49636502 CGGAGCAGCCAAGCCCCATGAGG + Intronic
1185366279 22:50438400-50438422 CAGAGCTGGCAGGACAGGTGTGG - Intronic
950454859 3:13086629-13086651 GGGAGCAGGCAGGTGCGGGGTGG - Intergenic
950504939 3:13388852-13388874 AGGAGCAGGCAGCCTCGGGGAGG - Intronic
953768614 3:45762303-45762325 CTGATCAGGCAGGCCAGGGGAGG - Intronic
954142179 3:48613762-48613784 GGAAGCAGGCAGGCCGGGTGCGG - Intergenic
954413303 3:50380682-50380704 GGGAGCAGGCAGGAAAGGTGGGG + Intronic
956721509 3:72122111-72122133 CAGAGCAGACAGGCCCAGTGGGG - Intergenic
956761345 3:72447348-72447370 CGGAGCGTGCAAGCCCGGCGGGG + Intergenic
956827412 3:73011187-73011209 CGGAGCTTTCAGGCCAGGTGCGG + Intronic
961165360 3:124759877-124759899 CTGAGCAGGCAGGGCCTCTGGGG + Intergenic
961460812 3:127049337-127049359 AGGAGCAGGCAGACAGGGTGGGG + Intergenic
961501442 3:127338504-127338526 CAGAGCAGGCAGGCAAGGAGAGG + Intergenic
962264352 3:133934839-133934861 AGGAGGAGGCAGGACTGGTGAGG + Intronic
962734779 3:138316120-138316142 AGGAGCAGACTGGCCAGGTGCGG - Intronic
966891313 3:184409485-184409507 CTGGACAGGCAGGCCCGGGGCGG + Intronic
966940985 3:184746913-184746935 CCAAGCAGGGAGGCCGGGTGAGG - Intergenic
968789189 4:2647690-2647712 GAGAGCAGGCAGGCCAGGGGTGG - Intronic
969532736 4:7738887-7738909 TGGGGCAGACAGGCCTGGTGAGG - Intronic
971446629 4:26757303-26757325 TGGAGCGGACAGGTCCGGTGTGG - Intergenic
971673067 4:29589538-29589560 AGGATCAAGCAGGCCAGGTGTGG + Intergenic
972788321 4:42347295-42347317 AGGGGCAGCCAGGCCCGGAGTGG - Intergenic
974928018 4:68325671-68325693 CTGAGCATTCAGGCCAGGTGTGG - Intronic
978814119 4:112883327-112883349 CTGATCAAGCAGGCCGGGTGCGG - Intronic
981719068 4:147780591-147780613 GGGAGCAGGCAGCCCTGTTGTGG + Intronic
987050430 5:14143635-14143657 CGGCGCCGCCAGGCCCGGCGCGG + Intergenic
987290655 5:16505429-16505451 CGGAGCACACAGCCCAGGTGTGG - Intronic
996405660 5:123099918-123099940 AGGTGCAGGCAGGCGCCGTGAGG + Exonic
996456793 5:123693710-123693732 CTGAGCAAGCATGCCTGGTGAGG + Intergenic
997382113 5:133445473-133445495 CAGGGCAGGCAGGGCCGATGGGG - Intronic
997867636 5:137478956-137478978 GGGAGCAGGGAGGCCTGGTGTGG - Intronic
998505377 5:142668019-142668041 CTGAGCAGGCAGGCCCCTGGGGG + Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
999315620 5:150582218-150582240 AGGAACAGGCAGGGTCGGTGGGG + Intergenic
999458271 5:151736227-151736249 TGGAGAAGCCAGGCCAGGTGCGG + Intergenic
999716767 5:154367414-154367436 CAGAGCAGCCAGGCTAGGTGGGG + Intronic
1000373774 5:160560802-160560824 CTGAGCAGGCAGGCCTTTTGAGG - Intergenic
1001556549 5:172641190-172641212 CGGAGCCGGCGGGCCCGGGCCGG + Intergenic
1002361718 5:178677202-178677224 TGGTGCAGCCAGGCCGGGTGCGG - Intergenic
1004000869 6:11595960-11595982 CTGACAAGGCAGGCCTGGTGAGG - Intergenic
1004483237 6:16040587-16040609 CAGAGCAGGCAGCCGCAGTGAGG - Intergenic
1006218926 6:32471327-32471349 GGGAGCAGGAAGCCCTGGTGTGG - Intergenic
1006347494 6:33494779-33494801 CAGAACAGGCAGGCCCGGTTGGG + Intergenic
1006406662 6:33849568-33849590 CTGAGCAGGCAAGTCAGGTGTGG - Intergenic
1006720979 6:36150809-36150831 AGGAACAGGCAGGGCTGGTGTGG - Intergenic
1007775810 6:44223749-44223771 CGGAGAAGGGACGCCGGGTGGGG + Exonic
1015880583 6:137867080-137867102 CGGGGCCCGCAGGCCCGGTCGGG + Intergenic
1016892680 6:149022307-149022329 AGCAGCAGATAGGCCCGGTGCGG + Intronic
1018013522 6:159693038-159693060 CGGTCCCGCCAGGCCCGGTGCGG + Intronic
1019529609 7:1496842-1496864 GGGAGCAGGGAGGCAGGGTGGGG - Intronic
1025928983 7:65980189-65980211 AGGAGCAGGCAGGGCGGGTGGGG - Intronic
1025998793 7:66545208-66545230 GGGAGCAGGCAGGCCAGCTGGGG - Intergenic
1028604751 7:92643594-92643616 CAGAGGAGGCAGGCCTGCTGAGG + Intronic
1029380468 7:100211112-100211134 AAGAGCAGGCAGCCCCTGTGGGG + Exonic
1029524794 7:101088046-101088068 GGGAGCAGGCGGCCCGGGTGGGG + Exonic
1030887860 7:114961079-114961101 CAGAGCAGGCAGGGGTGGTGCGG - Intronic
1032268057 7:130382018-130382040 CGCAGCAGGCTGGGACGGTGGGG + Intronic
1036155958 8:6341967-6341989 CAGAGCAGGCTGGCCTGGTTAGG - Intergenic
1037290119 8:17341463-17341485 CGGAGCAGCCAGCCCCTGTCCGG - Exonic
1037564881 8:20109644-20109666 TGGAGCAGGAAGGGCTGGTGGGG - Intergenic
1037662529 8:20940034-20940056 AGGAGCAGGCAGGCTGGGCGTGG + Intergenic
1042642405 8:70950962-70950984 AGGAGAAGGAAGGCCAGGTGCGG - Intergenic
1045253378 8:100499679-100499701 TGGAGCAGGAAGGCAAGGTGGGG - Intergenic
1045443767 8:102239484-102239506 CGGAGGAGGCGGGGCCGATGAGG - Intergenic
1049175355 8:141189370-141189392 CTCAGCAGGAAGGCCGGGTGTGG - Intronic
1049337891 8:142096210-142096232 AGGAGGAGCCAGGCCAGGTGGGG - Intergenic
1049710307 8:144060333-144060355 CGGAGCAGGCACGGGAGGTGGGG + Intronic
1049749829 8:144277799-144277821 CGGTGCGGGCAGGGGCGGTGCGG + Intronic
1049775484 8:144401925-144401947 CCTAGCAGCCAGGCCCTGTGCGG + Intronic
1057221282 9:93259217-93259239 CAGGGCAGCCACGCCCGGTGGGG - Exonic
1059463034 9:114447214-114447236 GGGAGCAGTCAGTCCAGGTGAGG - Intronic
1060526500 9:124324038-124324060 GGGAGCAGGCAGGGACAGTGGGG - Intronic
1060798319 9:126527429-126527451 GGGAGATGGCAGGCCCTGTGGGG - Intergenic
1061002684 9:127911186-127911208 CAGGGCAGGCAGGCCAGGAGTGG + Intronic
1061571031 9:131477529-131477551 AGGAGCAGGCAGAGCCGGTGGGG + Intronic
1061621228 9:131812499-131812521 CGGAGCTGGCAGGGCGGGTGAGG + Intergenic
1062259412 9:135653042-135653064 AAAAGCAGGCAGGCCCGGTGCGG - Intergenic
1062384386 9:136303371-136303393 TGGAGCAGGAATGCCCGGGGAGG - Intronic
1062384861 9:136305186-136305208 GGGTGCAGACAGGCCAGGTGGGG - Intronic
1062686394 9:137815626-137815648 AGGAGCTGGCAGCCTCGGTGAGG + Intronic
1188005887 X:25015579-25015601 CGGAGCAGGCAAGCTCTGCGCGG + Exonic
1188811382 X:34657196-34657218 CGGAGGCGGCCGGCCGGGTGTGG + Exonic
1189159979 X:38801509-38801531 GGGAGCTGGGAGGCCCGGTTTGG + Intronic
1197606329 X:128589911-128589933 CAGACAAGGCAGGCCGGGTGCGG + Intergenic
1197628193 X:128827119-128827141 GGGAGCAGGGAGGCCCGAGGGGG - Intergenic
1198750327 X:139932258-139932280 CGGGTCAGGCAGGCCGGGGGCGG - Intronic
1200036358 X:153334213-153334235 CGGCCCAGGCAGGCCTGGCGTGG - Exonic
1200092544 X:153642648-153642670 GGGGGCAGCCAGGCCGGGTGGGG - Intronic
1200141812 X:153906259-153906281 CCGGACAGGCAGCCCCGGTGAGG + Exonic
1200242698 X:154506261-154506283 TGGAGCAGGCTGGCCCGGGGTGG - Exonic