ID: 1160947529

View in Genome Browser
Species Human (GRCh38)
Location 19:1650686-1650708
Sequence CGGGCTGTTCCTCCCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160947529_1160947533 -3 Left 1160947529 19:1650686-1650708 CCGGGAAAGGGAGGAACAGCCCG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1160947533 19:1650706-1650728 CCGATCCTACCCCGCCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1160947529_1160947531 -4 Left 1160947529 19:1650686-1650708 CCGGGAAAGGGAGGAACAGCCCG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1160947531 19:1650705-1650727 CCCGATCCTACCCCGCCCCGAGG 0: 1
1: 0
2: 2
3: 10
4: 116
1160947529_1160947535 5 Left 1160947529 19:1650686-1650708 CCGGGAAAGGGAGGAACAGCCCG 0: 1
1: 0
2: 1
3: 18
4: 211
Right 1160947535 19:1650714-1650736 ACCCCGCCCCGAGGGAAATTTGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160947529 Original CRISPR CGGGCTGTTCCTCCCTTTCC CGG (reversed) Intronic
901749124 1:11395313-11395335 CGTACTGTTTCTCCCTCTCCAGG - Intergenic
902261318 1:15226893-15226915 GGGTCTTTTCCTCCCTCTCCTGG - Intergenic
902626556 1:17679940-17679962 GGGGCTGTGCCACCCATTCCCGG - Intronic
904344109 1:29856921-29856943 CTGGCTGTTCCTGCCTCTCTGGG + Intergenic
905273903 1:36805040-36805062 CGGGCTGGTCCTCTCTGTGCTGG - Exonic
906649426 1:47502200-47502222 TGGTCTGTTACTGCCTTTCCTGG + Intergenic
910996709 1:93112959-93112981 GGGGCTGTTGTTCCATTTCCAGG + Intronic
912691966 1:111811474-111811496 GGGTCTGTCCCTCCCTTACCTGG + Intronic
913250595 1:116909812-116909834 CCGGCTCTTCCTCCGTTACCTGG + Intergenic
913526999 1:119703064-119703086 CAGACTGTTTCTCCGTTTCCAGG + Intronic
914950258 1:152107855-152107877 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
914950299 1:152108167-152108189 GCTGCTGTTCCTCCCCTTCCTGG + Exonic
914950317 1:152108311-152108333 GCTGCTGTTCTTCCCTTTCCTGG + Exonic
914950339 1:152108503-152108525 GCTGCTGTTCCTCCCTCTCCTGG + Exonic
914950377 1:152108785-152108807 GCTGCTGTTCTTCCCTTTCCTGG + Exonic
914950425 1:152109160-152109182 GCGGCTGTTCCTCCCTTTCCTGG + Exonic
915294940 1:154913526-154913548 AGGGCTGTTTTTCCCCTTCCAGG + Intergenic
915516215 1:156414043-156414065 CAGTCTGTTCCACCTTTTCCTGG + Intronic
915989627 1:160500875-160500897 GGAGCTGTTCTTCCCTTGCCTGG + Intronic
918733167 1:188023303-188023325 CTGACTGTTCCTGTCTTTCCAGG + Intergenic
919215288 1:194545655-194545677 CTGGCTATTAATCCCTTTCCAGG + Intergenic
919657749 1:200214115-200214137 GGGGCTGTGCCTCCGCTTCCAGG + Intergenic
920719272 1:208371855-208371877 CGGGCTGTTCTTCTCTTATCTGG + Intergenic
920921628 1:210302364-210302386 AGCCCTGTTCCTCCCTGTCCTGG + Intergenic
923240944 1:232084982-232085004 CGGGCTGGTCCGTCCCTTCCAGG - Intergenic
1065065160 10:21955127-21955149 GGGGCTGTTCCCCCCTGCCCAGG - Intronic
1065415105 10:25476489-25476511 CAGGTTGTTCCTCCCTACCCCGG + Intronic
1066096211 10:32074911-32074933 CAGGCTGTTCCTTTCTTTCTTGG + Intergenic
1066967383 10:42281861-42281883 CTGGCTGGTCCTCTCTATCCCGG - Intergenic
1067769251 10:49111528-49111550 AGGGCAGATCCTCCCTCTCCTGG + Intronic
1070384346 10:75911177-75911199 TGGCTTGTCCCTCCCTTTCCTGG + Intronic
1071561220 10:86648395-86648417 TGGCCTGTTCCTCCTTTTGCTGG - Intergenic
1072468985 10:95694116-95694138 CGGGCCGTGCCTCCGTTGCCTGG + Exonic
1073099265 10:100998426-100998448 TGGGCTGTGTTTCCCTTTCCAGG + Intronic
1074986288 10:118662699-118662721 CTGGCTTTCCCTCCCTTCCCTGG - Intergenic
1075258364 10:120943250-120943272 CGGGCTTTTCCTCCCCTCTCTGG - Intergenic
1075826779 10:125363811-125363833 AGCTCTGTTCTTCCCTTTCCAGG - Intergenic
1076076365 10:127537088-127537110 CTGGCTGGGCCTCCCTGTCCAGG + Intergenic
1079160934 11:17993794-17993816 CGGGCTGTTCCCTCCTCACCTGG - Intronic
1080467444 11:32510968-32510990 CGGTCCGTTTCTCTCTTTCCTGG + Intergenic
1083763901 11:64833148-64833170 CAGGCTGTTTCTCCCATCCCAGG - Intronic
1083816520 11:65135276-65135298 CTGGTTGTCCCTCCCTGTCCTGG - Intergenic
1084870450 11:72095198-72095220 AGGTCTGTTACTCCCTTCCCAGG - Intronic
1086315714 11:85589611-85589633 CTGGCTTTCCCTCACTTTCCTGG - Intronic
1086796712 11:91113859-91113881 TGGGCTGTTCCTTTTTTTCCAGG + Intergenic
1088720491 11:112587891-112587913 AGGGCTGTGCCACCCTGTCCAGG - Intergenic
1089400991 11:118164598-118164620 CCTGCTGTTTCTCCCTTCCCAGG + Exonic
1089494622 11:118901944-118901966 CGGGGCGGACCTCCCTTTCCTGG - Exonic
1089781914 11:120879197-120879219 CTGGCTATTCCTCACTTTCCTGG + Intronic
1091075723 11:132614222-132614244 TGGTCTGTTTTTCCCTTTCCTGG + Intronic
1095576438 12:43745464-43745486 GGGGCTTTTCCTCCTTTGCCTGG + Intronic
1096498078 12:52050236-52050258 CGGGCTGTTCCTCACTCCACCGG + Intronic
1096582727 12:52598778-52598800 CTGGATGTTCCTCCCTCCCCCGG + Intronic
1097487828 12:60228128-60228150 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1097888998 12:64759013-64759035 CGGTTTGTTGCTCTCTTTCCCGG - Intronic
1098875209 12:75859927-75859949 CGGCCTCTTTGTCCCTTTCCTGG - Intergenic
1102581620 12:113892033-113892055 CGGGCTGATCCTTTCTTTACAGG - Intronic
1103340585 12:120219272-120219294 CTGGCTGTTCCTTCCCGTCCTGG + Intronic
1103700992 12:122848699-122848721 CGGGCTGTTCCTCCCGCCTCGGG + Intronic
1104568877 12:129908098-129908120 AGGGATGTGCCTCCCTTTCAGGG + Intergenic
1106778584 13:33032687-33032709 CTGGCTGTTCCTCCCATTGGCGG - Intronic
1107784657 13:43942812-43942834 CGGGATGTATCTTCCTTTCCTGG + Intergenic
1107833324 13:44393546-44393568 CCTGCTGTCCCTCCCTTTCTTGG + Intronic
1109150638 13:58843461-58843483 CTGGCTTTTCCTCACTTCCCTGG + Intergenic
1109546757 13:63842476-63842498 CGGGGTGTGCCTCCCTCTCCGGG - Intergenic
1109929687 13:69198613-69198635 GGGGCTGTTACTCCCTTTATTGG + Intergenic
1111440204 13:88272544-88272566 CCAGCTGCTCCTCCCCTTCCTGG - Intergenic
1113810748 13:113141092-113141114 CGGGCTTGTCCTCCCTGGCCCGG - Intronic
1121239407 14:92418031-92418053 GAAGCTGTTCCTTCCTTTCCAGG + Intronic
1121314132 14:92951090-92951112 TGGTCTCTTCCTCCCTGTCCTGG - Intronic
1122307943 14:100777264-100777286 GGGGCCCTTCCTGCCTTTCCTGG + Intergenic
1122328910 14:100899883-100899905 CGGGCAGCTGCTCCCTTTCAGGG + Intergenic
1123030775 14:105450083-105450105 CGGGCAGGTCCACCATTTCCGGG - Exonic
1123063956 14:105606815-105606837 CGGGCTGTTCCTCTCCTGCCCGG + Intergenic
1123073269 14:105652458-105652480 TGGGCTGTTCCTCTCCTGCCCGG + Intergenic
1123093197 14:105751225-105751247 TGGGCTGTTCCTCTCCTGCCAGG + Intergenic
1125366360 15:38920835-38920857 GGGACTGTTCCACCCTTCCCTGG + Intergenic
1126919928 15:53509809-53509831 AGGGATGGTCTTCCCTTTCCAGG + Intergenic
1128764651 15:70243799-70243821 AGGGCTGTGCCTCCCTCTCCAGG + Intergenic
1132578300 16:673947-673969 AGGGCTCTACCCCCCTTTCCTGG + Exonic
1132610335 16:812906-812928 GGGACTGTTCCTCCCTGTCGGGG - Intronic
1132643111 16:987039-987061 CGGCCTGATCCTGCCTTTGCCGG - Intergenic
1133223357 16:4328559-4328581 GGGGCAGCTCCTTCCTTTCCCGG + Intronic
1133319084 16:4902051-4902073 TGGCCTGTCGCTCCCTTTCCTGG - Intronic
1138605857 16:58088344-58088366 CTGCCTTTTCCTGCCTTTCCTGG + Intergenic
1139969793 16:70766676-70766698 TGGGCTTTTCTTCCCTTGCCTGG + Intronic
1141270831 16:82539983-82540005 GAGGCTGTTTCTCCCTTTCCAGG - Intergenic
1141684741 16:85563786-85563808 CGGGCTGTCCCTCCCTTCTCTGG + Intergenic
1141695374 16:85616570-85616592 AGGGCTTCCCCTCCCTTTCCTGG + Intronic
1142291982 16:89197371-89197393 TGTGCTGTTCCTCTCTGTCCTGG - Exonic
1142344323 16:89544517-89544539 CGGGCTGTTCCTTTCTCTCTGGG + Intronic
1143209381 17:5172722-5172744 AGGGTTGGTCTTCCCTTTCCTGG + Intronic
1144618863 17:16802176-16802198 AGGGTTGGTCTTCCCTTTCCTGG + Intronic
1144847332 17:18226699-18226721 GAGGCTTTTCCTTCCTTTCCCGG + Intronic
1144864116 17:18323914-18323936 CTGGCTGCTCCTCCCTTGCATGG - Intergenic
1145138385 17:20430755-20430777 AGGGTTGGTCTTCCCTTTCCTGG + Intergenic
1147969751 17:44212926-44212948 CGGGGTGATCCTCCCTAGCCAGG + Exonic
1148867319 17:50635226-50635248 CGCACTCTTCCTCACTTTCCCGG - Intronic
1149870761 17:60179489-60179511 AGGGTTGGTCTTCCCTTTCCTGG - Intronic
1150448727 17:65247877-65247899 GGGGATGTTCCTTCCTTCCCAGG + Intergenic
1151292915 17:73163473-73163495 CTGGCTCTTCCTTCTTTTCCTGG + Intergenic
1151844642 17:76643795-76643817 AAGGCGGTTCCTCCCTTCCCAGG - Exonic
1152385350 17:79970860-79970882 CGGGCTGACTCTCCGTTTCCAGG - Intronic
1154077993 18:11224024-11224046 CTGAATGTTCCCCCCTTTCCTGG - Intergenic
1160739597 19:679850-679872 TGGGGTGTTCCGCCCTTGCCAGG - Intronic
1160947529 19:1650686-1650708 CGGGCTGTTCCTCCCTTTCCCGG - Intronic
1163685947 19:18711686-18711708 CGGGCAGTTCCGCCCATTCCCGG + Intronic
1167038274 19:47007213-47007235 CGGCCTGTTCCTCCCTTCTTTGG + Intergenic
1167202362 19:48074788-48074810 GGGGCTGCTCCTGCTTTTCCAGG + Exonic
926314377 2:11698411-11698433 TGTGCTGTTCCTACGTTTCCCGG - Intronic
926711997 2:15889305-15889327 AGGGCTGTACCTGCCTCTCCAGG + Intergenic
926744211 2:16137380-16137402 CTTGCTGTTCCTCCCTTTTTAGG - Intergenic
931357496 2:61549954-61549976 CAGCCTCTTCCTCCCTTACCGGG + Intergenic
935163717 2:100551343-100551365 CCGGGGGTTCCTCCCTTTCGTGG - Intergenic
937200840 2:120203756-120203778 CAGCCTTTCCCTCCCTTTCCAGG + Intergenic
937666220 2:124490017-124490039 CTGCCTGTTCCTCCATTTCTTGG - Intronic
937841909 2:126532935-126532957 CGGCCTTTGCCTCCCTTTCAAGG + Intergenic
937875560 2:126823015-126823037 GGGGCTCCTCCTCCCTGTCCAGG + Intergenic
941844605 2:170120688-170120710 GAGTCTGTTTCTCCCTTTCCTGG - Intergenic
941916287 2:170816049-170816071 GGGGCTGGTCCGCCCCTTCCGGG + Intronic
946137095 2:217656400-217656422 CAGGCTGGTCCTCCGTGTCCTGG + Intronic
946959127 2:224964816-224964838 CGGGCTGTTCTCCCCTTTTGAGG - Intronic
947403925 2:229755346-229755368 CTAGCTCTTCCTCCCTTTCCTGG + Intergenic
948321212 2:237071410-237071432 AGGTCTGTTCTTCTCTTTCCAGG - Intergenic
949061143 2:241958232-241958254 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1172121819 20:32603143-32603165 CTGGCAGTTCCACCCGTTCCAGG + Intronic
1173209078 20:41017789-41017811 GGGTCTGTCCCTACCTTTCCAGG - Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175753141 20:61513109-61513131 CCGTCCATTCCTCCCTTTCCAGG + Intronic
1176163307 20:63659559-63659581 CGGGGTGTGCTTCCCTCTCCCGG + Intronic
1177127712 21:17216988-17217010 CCGGCTTTTCCCCACTTTCCTGG + Intergenic
1178764930 21:35441409-35441431 CTCTCTTTTCCTCCCTTTCCTGG - Intronic
1179879350 21:44286996-44287018 CGGGGGCTTCCTCCCCTTCCGGG - Exonic
1179993822 21:44964436-44964458 CTTGCTGTTCCTCCCGTTGCAGG + Intronic
1184037706 22:41926420-41926442 CCGGCTGTCCCTCCCCTCCCCGG - Intronic
1184503877 22:44889663-44889685 CGGGCTCTTTCCCTCTTTCCAGG + Intronic
1184693208 22:46126712-46126734 CAGGCTGCTCCTCCCTGCCCAGG + Intergenic
1185417746 22:50719657-50719679 GGGGCTGTCCCTGCCTTTCTGGG + Intergenic
950451482 3:13068023-13068045 GGGGCTGATACTCCCCTTCCAGG - Intronic
952478014 3:33731328-33731350 CAGGCTGTATCTCCTTTTCCTGG - Intergenic
954385857 3:50243426-50243448 GGGGCTGTTGCTGCATTTCCAGG - Intronic
955044944 3:55350819-55350841 AGGCCTTTTCCTCCTTTTCCAGG + Intergenic
955149894 3:56356615-56356637 CTGGCCTTTCCTTCCTTTCCTGG + Intronic
958053420 3:88379262-88379284 CTGCCTGTTCCTCCCTCTGCTGG + Intergenic
962517258 3:136163813-136163835 GGGGCTCTTCCTCCCTTCACTGG + Intronic
963210751 3:142686918-142686940 CAGGTTGTTGCTTCCTTTCCTGG - Intronic
963304416 3:143635190-143635212 CTGGCTGTCGCTCCCTCTCCAGG + Intronic
963401759 3:144806980-144807002 CTGGCTGTAGCCCCCTTTCCAGG + Intergenic
966107875 3:176359473-176359495 CTTTCTTTTCCTCCCTTTCCTGG - Intergenic
968944316 4:3655493-3655515 GGGGCTGATCCTCCCTCCCCAGG + Intergenic
968944367 4:3655620-3655642 GGGGCTGATCCTCCCTCCCCAGG + Intergenic
969312938 4:6364651-6364673 GGGGCTTTTCCTCGCTTTACAGG + Intronic
969601800 4:8181260-8181282 CTCTCTGTGCCTCCCTTTCCTGG - Intergenic
970520647 4:16880496-16880518 AGCGCTGTTCCTCTCTTTTCAGG - Intronic
972202032 4:36724653-36724675 CTGGCTCTTCCTTCCTTTTCTGG - Intergenic
978885344 4:113761399-113761421 CTGGCTGTTTTTCCATTTCCCGG - Intronic
979073808 4:116244743-116244765 GGGGCTTTTCCTCCTTTTCTGGG + Intergenic
979078750 4:116307670-116307692 CAGGCTCTGCCTCCTTTTCCTGG - Intergenic
981545822 4:145892196-145892218 CTGGCTGTGCCTGCCTCTCCAGG + Intronic
983550262 4:169010267-169010289 CGAGCTCTTCCTCCTTTTCACGG - Intronic
984849764 4:184143581-184143603 CCCGCTGTGCGTCCCTTTCCTGG + Intronic
985517433 5:354237-354259 GGGGCTGTTCCTCCCCGTGCTGG + Intronic
986468521 5:8050783-8050805 TCAGCTGTTTCTCCCTTTCCAGG - Intergenic
989819925 5:45784762-45784784 GAGGCTTTTCCTCCCTTTCCTGG + Intergenic
990561938 5:56992079-56992101 CGGCCTGAAGCTCCCTTTCCAGG + Intergenic
990578589 5:57147403-57147425 CGGCCTGAAGCTCCCTTTCCAGG - Intergenic
992564941 5:77987322-77987344 GGGGCTGTCTCTCCCATTCCTGG + Intergenic
994699274 5:103113018-103113040 AGTGCTTTTCCTCCTTTTCCAGG - Intronic
997266108 5:132496295-132496317 CCTGCTGGCCCTCCCTTTCCAGG - Intergenic
998250626 5:140549788-140549810 AGGGCTGTTCCTGTCTTCCCAGG + Intronic
998338252 5:141393410-141393432 CAGCCTCTTCCTCCCTGTCCAGG - Exonic
999089235 5:148920944-148920966 CTGGGTGATCCTCCCATTCCTGG + Intergenic
1001575716 5:172762699-172762721 GGGTCTGTGCCTCCGTTTCCAGG - Intergenic
1005067874 6:21836040-21836062 CGTGCAGTTCCTTCCTTTCCAGG + Intergenic
1006239553 6:32665277-32665299 CAGGGCTTTCCTCCCTTTCCTGG - Intronic
1007487878 6:42194897-42194919 GGCCCTCTTCCTCCCTTTCCAGG + Exonic
1009325123 6:62339365-62339387 TGGGGTGTGCCTCCCTCTCCAGG + Intergenic
1010606088 6:77890842-77890864 GGGGCTTTTCCTCCTTTGCCTGG + Intronic
1010809952 6:80289856-80289878 AGGGCTCTTCATCCCTTTCTGGG + Intronic
1013321088 6:108990380-108990402 CTTGCTTGTCCTCCCTTTCCTGG + Intronic
1018375107 6:163203052-163203074 CGGGCCGTTCCTCATCTTCCTGG + Intronic
1018729076 6:166635660-166635682 CGGGCTCTTCCTCCTCTTCTGGG - Intronic
1019129681 6:169864507-169864529 CGGGCAGGTCATCCCTTTGCAGG + Intergenic
1019172063 6:170138201-170138223 CCGCCTGTTCCTCCCAGTCCTGG - Intergenic
1019177787 6:170169231-170169253 CGGGATGTTCCTGCCTGTTCGGG + Intergenic
1019178096 6:170170886-170170908 GGGGTTGTTCCTCTCTTTTCGGG + Intergenic
1019178150 6:170171186-170171208 GGGGTTGTTCCTCCCTGTTCTGG + Intergenic
1019178201 6:170171486-170171508 CGGGTTGTTCCTCCCTGTTCTGG + Intergenic
1019178247 6:170171766-170171788 GGGGTTGTTCCTCCCTGTTCCGG + Intergenic
1022420959 7:30222963-30222985 TGGGCTTTCCCTCCCTTTGCTGG - Intergenic
1022947537 7:35302490-35302512 GGGACTGTTCCTCCCCTTTCAGG + Intergenic
1023850813 7:44149330-44149352 CGGACTGCTGCTCCCTTTCCTGG + Intronic
1023987742 7:45107014-45107036 TGGGGTGCTCCTCCCTTTGCAGG - Intronic
1024606698 7:51027885-51027907 TGGGCTTTTCCTCTCTTTCTAGG + Exonic
1026955137 7:74372278-74372300 CGGGCTGTGCCTCCCACTCCCGG - Intronic
1028380298 7:90192453-90192475 CGGGATTTTTCTCCTTTTCCTGG + Intronic
1029178964 7:98685665-98685687 CTGTCTGGTCCACCCTTTCCCGG - Intergenic
1032458713 7:132093585-132093607 AGGGCTGTCTCTCCATTTCCAGG + Intergenic
1038610254 8:29054329-29054351 GGGGCTGTTCCTTCCTGTCGAGG + Intronic
1040470439 8:47731784-47731806 TGGGCAGTTCCCCCCTTTCTGGG - Intronic
1041451675 8:58012880-58012902 CAGTCTGTTCTTCCCTTTCCTGG + Intronic
1044197617 8:89396412-89396434 CGGGCTCTTGATCCATTTCCAGG + Intergenic
1044800169 8:95945591-95945613 CGGCCTGTTCATCCCTCTTCTGG + Intergenic
1047365025 8:124203741-124203763 AGGGCTGTTCCTCCTTTGCCAGG - Intergenic
1048172197 8:132117816-132117838 CGGGCTGTTGCTAGCTTTGCAGG + Intergenic
1048524032 8:135184828-135184850 CATTCTATTCCTCCCTTTCCAGG + Intergenic
1048748313 8:137641457-137641479 AGGGCTCTTCCCCCTTTTCCTGG + Intergenic
1049385030 8:142338857-142338879 TGGGCTATTCTTCCCTTCCCTGG - Intronic
1049708979 8:144055243-144055265 GGTCCTGTTCCTCCCTTTCCTGG - Intronic
1050101846 9:2128096-2128118 TGGGCTGTTTCTCTCTTCCCCGG + Intronic
1053314653 9:37041191-37041213 AGGGCTGTGCACCCCTTTCCAGG - Intergenic
1054797458 9:69316012-69316034 CTGTCTGTTTGTCCCTTTCCTGG - Intergenic
1054880697 9:70141901-70141923 CAGAATGTTCCTCCCTTTCTGGG + Intronic
1055171534 9:73265254-73265276 GGGGCTCTTCCCCCCTTTCCTGG + Intergenic
1055171784 9:73267209-73267231 GGGGCTCTTCTCCCCTTTCCTGG + Intergenic
1056544589 9:87603101-87603123 TGGGCTGGGCCTCCCTATCCTGG + Intronic
1061054819 9:128216901-128216923 CAACCTGTTCCCCCCTTTCCTGG + Intronic
1061417674 9:130455983-130456005 AGGGCTCTTTCTCCCCTTCCTGG - Intronic
1061453933 9:130683745-130683767 CTGCCTGTGCCTCCATTTCCAGG - Intergenic
1061609845 9:131739444-131739466 CGGGCTGTTCTTCCCCTGCTTGG + Intronic
1187930871 X:24292524-24292546 AGGGCTGTTCTTCACTTTCTCGG - Intergenic
1189168981 X:38890773-38890795 CTTTCTGTTCCTCCCTTCCCCGG + Intergenic
1189365429 X:40384360-40384382 CAGGCTGTTCCTGCCTTCCCAGG + Intergenic
1190031514 X:46977743-46977765 CTGGCTGCTCCTTCCTTACCCGG - Intronic
1190539470 X:51462149-51462171 CCTGCTGTTCCTCCATTTCTTGG + Intergenic
1192609627 X:72554607-72554629 CCGGCTTTCCCTCACTTTCCTGG + Intronic
1194049772 X:89054283-89054305 GGGGCTTTTCCACCCTTTCGTGG - Intergenic
1197103125 X:122680098-122680120 GGGGCTTTTCCCCCTTTTCCTGG - Intergenic
1197766169 X:130060611-130060633 CTGGCTGCCCCTCCCTTCCCGGG + Intergenic
1198678732 X:139158273-139158295 CTGGCTGCACCCCCCTTTCCAGG - Intronic
1202604404 Y:26626700-26626722 GGGGCTGTGCCTCCACTTCCAGG - Intergenic