ID: 1160947973

View in Genome Browser
Species Human (GRCh38)
Location 19:1652280-1652302
Sequence CAGGTGAGCCCGGCGGGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 467}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160947973_1160947988 7 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947988 19:1652310-1652332 CGGCCGGGCACGCGGCGCGTGGG 0: 1
1: 0
2: 1
3: 19
4: 158
1160947973_1160947989 8 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947989 19:1652311-1652333 GGCCGGGCACGCGGCGCGTGGGG 0: 1
1: 0
2: 2
3: 36
4: 211
1160947973_1160947984 -8 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947984 19:1652295-1652317 CTCACCTGCTGGGCGCGGCCGGG 0: 1
1: 0
2: 2
3: 15
4: 198
1160947973_1160947994 12 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947994 19:1652315-1652337 GGGCACGCGGCGCGTGGGGGGGG 0: 1
1: 0
2: 2
3: 32
4: 363
1160947973_1160947995 13 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947995 19:1652316-1652338 GGCACGCGGCGCGTGGGGGGGGG 0: 1
1: 0
2: 4
3: 40
4: 368
1160947973_1160947992 10 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947992 19:1652313-1652335 CCGGGCACGCGGCGCGTGGGGGG 0: 1
1: 0
2: 1
3: 12
4: 178
1160947973_1160947987 6 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947987 19:1652309-1652331 GCGGCCGGGCACGCGGCGCGTGG 0: 1
1: 1
2: 5
3: 55
4: 423
1160947973_1160947983 -9 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947983 19:1652294-1652316 GCTCACCTGCTGGGCGCGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 190
1160947973_1160947990 9 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947990 19:1652312-1652334 GCCGGGCACGCGGCGCGTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 235
1160947973_1160947993 11 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947993 19:1652314-1652336 CGGGCACGCGGCGCGTGGGGGGG 0: 1
1: 0
2: 2
3: 35
4: 199
1160947973_1160947999 30 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947999 19:1652333-1652355 GGGGGGCGGCGGCATGAAGCGGG 0: 1
1: 0
2: 1
3: 14
4: 258
1160947973_1160947997 19 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947997 19:1652322-1652344 CGGCGCGTGGGGGGGGGCGGCGG 0: 1
1: 1
2: 16
3: 185
4: 1891
1160947973_1160947998 29 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947998 19:1652332-1652354 GGGGGGGCGGCGGCATGAAGCGG 0: 1
1: 0
2: 0
3: 24
4: 353
1160947973_1160947986 -1 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947986 19:1652302-1652324 GCTGGGCGCGGCCGGGCACGCGG 0: 1
1: 0
2: 4
3: 40
4: 396
1160947973_1160947996 16 Left 1160947973 19:1652280-1652302 CCGCCCCCCGCCGGGCTCACCTG 0: 1
1: 0
2: 1
3: 74
4: 467
Right 1160947996 19:1652319-1652341 ACGCGGCGCGTGGGGGGGGGCGG 0: 1
1: 0
2: 2
3: 70
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160947973 Original CRISPR CAGGTGAGCCCGGCGGGGGG CGG (reversed) Exonic
900114143 1:1021323-1021345 CAGATGACCCAGGCAGGGGGAGG - Intronic
900123612 1:1059780-1059802 CAGGTGAGCCCGGCGCACGGCGG + Intergenic
900184430 1:1326305-1326327 CAGGTGGGGCCGGGGGTGGGGGG - Intronic
900185828 1:1332804-1332826 CAGGTGAGCCCGGGAGATGGGGG + Exonic
900322789 1:2093365-2093387 CAGGTCAGACCGCCGGGGTGTGG + Intronic
900419096 1:2547901-2547923 CAGGTGAGCCCGTGGGGGTTGGG - Intergenic
900459806 1:2797483-2797505 CAGGTGAGCCCTGAGGTGAGAGG - Intronic
900516919 1:3086537-3086559 CAAGGCAGCCCGGCGGGAGGAGG - Intronic
900584448 1:3425748-3425770 CAGGTGGGCCACGCGGGGTGGGG + Exonic
900968013 1:5972966-5972988 CACCTGAGCTCGGCGGGTGGAGG - Intronic
901006019 1:6171870-6171892 CAGGTGGGCCAGGAGGGTGGTGG - Intronic
901810444 1:11764318-11764340 CAGATGGGCCCTGCGGGGAGAGG - Exonic
902263865 1:15247393-15247415 CAGGTGAGTGCGGCGCGGGAAGG + Exonic
902644865 1:17791084-17791106 CAGCTGTGCCTGGCAGGGGGTGG + Intronic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
903038153 1:20508108-20508130 CAGGTTAGGCCGGGGGGGTGCGG - Exonic
903138275 1:21323278-21323300 CAGCTGGAACCGGCGGGGGGAGG + Intronic
903223913 1:21884492-21884514 CGGGTGAGCGCTGCGGGAGGTGG - Intronic
903384644 1:22918391-22918413 GAGCTGAGCCTGGCGGGGGCGGG + Intergenic
904036198 1:27560285-27560307 CAGGTGAGCCCAGCTGTGGCTGG + Intronic
904063482 1:27729289-27729311 CATTTGAGCCCGGAGAGGGGAGG - Intronic
905123759 1:35702714-35702736 TAGGTGAGGCCTGCAGGGGGCGG + Intergenic
905189703 1:36224206-36224228 CAGGCCACCCAGGCGGGGGGAGG + Intergenic
906102146 1:43270667-43270689 CAGGTGAGCCTGCCGGGAGGAGG - Exonic
907514747 1:54986444-54986466 CAGGTCAGCAGGGCGGGGTGTGG + Exonic
908534554 1:65066419-65066441 CAGGTGAGCCCGGGGAGAAGCGG + Intergenic
909393108 1:75137097-75137119 CAGGTGAGCCCCGAGGGAGCGGG + Exonic
910806263 1:91192222-91192244 GAGGTGAGCCCAGAGCGGGGTGG - Intergenic
911144822 1:94541858-94541880 CAAGTGACCCGGGCCGGGGGCGG - Intergenic
913020088 1:114780623-114780645 TAGCTGAGCCCGGCAGGGGCTGG - Exonic
913421578 1:118675643-118675665 TAAGTAAGGCCGGCGGGGGGTGG + Intergenic
914834957 1:151199079-151199101 CAGGTAAGCCCGGCAGGGCGTGG + Exonic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915367876 1:155325488-155325510 CAGGTGAGCCAGGAGGGCGTGGG + Exonic
916430968 1:164728032-164728054 GAGGTGAGCCAGGCTGGGCGTGG + Intronic
917485784 1:175453431-175453453 AAGATGAGCCCGGAGAGGGGAGG + Intronic
917962279 1:180154733-180154755 CAGGAGCGGCCGGCGGGGCGGGG + Intergenic
918018323 1:180659600-180659622 CGCTTGAACCCGGCGGGGGGTGG - Intronic
918047341 1:180949441-180949463 CGGTTGAGGCCGGCGGGCGGGGG + Exonic
918775839 1:188628957-188628979 CACCTGAGCCTGTCGGGGGGTGG + Intergenic
919014348 1:192011742-192011764 CAGGCAAGGCCGGCGGGGGCGGG - Intergenic
922196458 1:223364098-223364120 CGGGTTAGACTGGCGGGGGGAGG - Intronic
923119667 1:230978616-230978638 CAGGAGGCCCCGGCGGGCGGCGG - Exonic
924603224 1:245509816-245509838 CAGGTGAGGCAGGCTGGGAGGGG - Intronic
924740367 1:246791286-246791308 CAGGGGAGCAGGGCGGGGAGAGG - Intergenic
1067060108 10:43073922-43073944 CAGGTTTGCCTGGCGGGAGGCGG - Intergenic
1067998324 10:51301640-51301662 CAGGAGAGCCAGGCGAGGGATGG + Intronic
1069750860 10:70744187-70744209 CAGGTGAGCCGGGCTGGGGCTGG + Exonic
1070351543 10:75597448-75597470 CAGGTGAGCCAGGAGGGGACTGG + Intronic
1070657261 10:78279944-78279966 CAGGGGAGCTGGGCGGGGGCAGG - Intergenic
1070734301 10:78852779-78852801 CAGCTGAGCCTGGTGAGGGGTGG - Intergenic
1070826671 10:79394256-79394278 CAGGTGAGCCGGGCAGGCTGGGG - Exonic
1071489180 10:86124322-86124344 CAGGTGAGCCAGGGGGAGAGTGG - Intronic
1072700921 10:97640877-97640899 CCGGCGAGCCCGGCGGAGAGGGG - Exonic
1072757534 10:98030747-98030769 CCGGAGAGCCGGGCGTGGGGAGG + Exonic
1075430397 10:122375119-122375141 CAGCGGCGCCCGGCGGGGGAGGG + Intronic
1075802310 10:125160807-125160829 GGGGTGAGCGCGGCGCGGGGCGG - Intronic
1076121379 10:127939691-127939713 CAGCTGAGCCCAGCAGGGGCAGG + Intronic
1076297137 10:129394918-129394940 CAAGTGCACCCGGCGGGGTGGGG - Intergenic
1076776671 10:132701668-132701690 CAGGTGCGCCCGTGGGGGCGTGG + Intronic
1076792614 10:132785260-132785282 AAGGTGAGCGCGGCGGGGCTCGG - Exonic
1076843316 10:133057127-133057149 CAGGTGAGGAGGGCGGGAGGAGG + Intergenic
1077063259 11:626868-626890 CAGGTGAGGCCGGGTGGGGTGGG - Exonic
1077121441 11:910755-910777 CAGGTGAGCCCCGCGGCGGCCGG - Intronic
1077122752 11:917808-917830 CAGGTGACACCAGCTGGGGGAGG - Intergenic
1077382151 11:2249161-2249183 CAGGTGGGCTGTGCGGGGGGTGG + Intergenic
1077419723 11:2444706-2444728 CAGGTGGGCTCGGGCGGGGGTGG + Intronic
1078334152 11:10450826-10450848 CAGGAGGGCCCCGCGGGAGGAGG - Exonic
1078891373 11:15561203-15561225 CGCAGGAGCCCGGCGGGGGGCGG - Intergenic
1079242345 11:18729599-18729621 CAGGGCAGCCCAGCGGGTGGGGG + Intronic
1079296907 11:19241954-19241976 CAGGTGAGCCGGCCTGGGGCTGG - Intergenic
1080746481 11:35112615-35112637 CAGGTGATGGGGGCGGGGGGCGG + Intergenic
1081863615 11:46347818-46347840 CAGGTGAGCGGGGCGGCGGCGGG + Intronic
1083656850 11:64234174-64234196 CAGGTGAGCCCCTCAGGGGCCGG - Exonic
1083678690 11:64341596-64341618 CAGGTGACCCAGCCGGGGGCCGG + Exonic
1083764488 11:64835480-64835502 CAGGTGAGCCAGGCAGCTGGTGG - Exonic
1084004118 11:66314281-66314303 CAGTTGAGCCCAGCAGTGGGAGG - Intergenic
1084085177 11:66851770-66851792 CAAGTGAGCCTGGGGTGGGGTGG - Exonic
1084175715 11:67421217-67421239 CAGGTGGGCGGGGCGCGGGGCGG + Exonic
1084184668 11:67465159-67465181 TGGGTGAGCCGGGCTGGGGGTGG - Intronic
1084192125 11:67504083-67504105 CAGGTGAGGGCGGCGGGGAGAGG - Exonic
1084286491 11:68134604-68134626 CAGGTGAAGCCGGCCGGGCGCGG + Intergenic
1084758054 11:71251692-71251714 CTGGTGAGCACGGCGGGCCGGGG + Intronic
1084958243 11:72702885-72702907 CAGGTGAGCGTGGCAGAGGGTGG - Exonic
1085158993 11:74323793-74323815 CACTTGAGCCCGGGAGGGGGAGG - Intergenic
1085909955 11:80811479-80811501 CAGGTGGGCCTGGTGGGAGGTGG - Intergenic
1086561555 11:88175163-88175185 CAGGTGAGCGCGGGGGGAGGGGG - Exonic
1090187037 11:124745727-124745749 CAGGTGAGGCGGGCGGCGCGCGG + Exonic
1090680857 11:129056328-129056350 CACGTGAGCCTGGCAGGTGGAGG - Intronic
1092171340 12:6375592-6375614 AAGGTGAGCAGGGCGGGGGGAGG + Intronic
1097119656 12:56721376-56721398 CAGGAGAGCAAGGAGGGGGGAGG + Exonic
1097235997 12:57539966-57539988 CAGTTGAACCCGGCAGGCGGAGG + Intronic
1097863943 12:64543532-64543554 CAGGAGCCCACGGCGGGGGGCGG - Intergenic
1098369179 12:69739029-69739051 CAGGTGAGTGCGGCCGCGGGAGG + Intronic
1101504159 12:105330935-105330957 AAGGTGAGTCCGGCGGGAGGCGG + Exonic
1102297031 12:111745095-111745117 CAGGTGAGCCCGGTGGGGTCGGG - Intronic
1103350313 12:120278926-120278948 CAGGGGAGCCCGGGGCAGGGAGG + Intergenic
1103541978 12:121672549-121672571 CAGGTGAGCCGGGCGCAGGTGGG - Intronic
1103698596 12:122835812-122835834 CCGCGGAGGCCGGCGGGGGGCGG - Intronic
1104857473 12:131908835-131908857 CAGGCGGGCCCGGCGGGGAGGGG + Intronic
1105327289 13:19382278-19382300 CAGCAGAGCCCGGGGGGAGGCGG - Intergenic
1106776672 13:33016325-33016347 CAGCGGAGCCCGCCGGGGAGCGG + Intergenic
1110572965 13:77026669-77026691 CAGGAGTGCCGGGCGGGGCGCGG - Intronic
1113593752 13:111517883-111517905 CAGGTGAGGGAGCCGGGGGGTGG - Intergenic
1113593840 13:111518078-111518100 CAGGTGAGGGAGCCGGGGGGGGG - Intergenic
1113831436 13:113298405-113298427 CGGGGGAGGGCGGCGGGGGGAGG - Intronic
1115556150 14:34546495-34546517 CAGATGAGCACGGCGCGCGGAGG + Intergenic
1115557758 14:34556586-34556608 CAGATGAGCACGGCGCGCGGAGG - Intergenic
1117425989 14:55597768-55597790 CATTTGAGCCCGGGAGGGGGAGG + Intronic
1119304027 14:73592414-73592436 CAGGTGAGCCAGGCTGCTGGCGG + Exonic
1119432630 14:74578481-74578503 CAGGGGAGCCCGGGGCAGGGGGG - Intronic
1120190567 14:81436241-81436263 CAGGTGGAGCGGGCGGGGGGCGG - Intronic
1120834476 14:89027498-89027520 CAGGGGTGCCCGGGGTGGGGTGG + Intergenic
1121283429 14:92715734-92715756 CAGATCAGCCCAGCGGGGAGAGG - Intronic
1121408316 14:93732815-93732837 CAGCTGAGCCCGGCGGGGCTGGG + Intronic
1121917442 14:97848678-97848700 CAGGTCAGCCCGGCCGCAGGAGG + Intergenic
1122102129 14:99420937-99420959 CAGGCGAGGGCGGGGGGGGGGGG + Intronic
1122145188 14:99684534-99684556 CAGGTGAGCGGGGCTGGGGGCGG + Exonic
1122208093 14:100158325-100158347 CAGTTGAGCCCAGTGGGGAGAGG + Intronic
1122208400 14:100159708-100159730 CAGGTGCGCCAGGCTTGGGGCGG + Exonic
1122716130 14:103698144-103698166 CAGGAGAGCCTGGGGGTGGGGGG - Exonic
1122874467 14:104657304-104657326 CATCTGAGCCCTGCGGGGGCAGG - Intergenic
1122913159 14:104843595-104843617 CAGGCGAGCCCGGGGGACGGAGG - Intergenic
1122922562 14:104886042-104886064 CAGGGGAGCCCGGCACCGGGAGG - Exonic
1122977504 14:105176943-105176965 CAGGTGAGGCCAGCTGGGGTGGG - Exonic
1123024998 14:105420202-105420224 GGGGTGAGCACGGCGGGGGGCGG - Intronic
1123068139 14:105628351-105628373 CAGGTGAGCAGGGCAGGTGGGGG - Intergenic
1123072147 14:105647131-105647153 CAGGTGAGCAGGGCAGGTGGGGG - Intergenic
1123092156 14:105746649-105746671 CAGGTGAGCAGGGCAGGTGGGGG - Intergenic
1123625353 15:22223401-22223423 AGGGTGAGCCCTGCGGGTGGGGG - Intergenic
1125716724 15:41823696-41823718 CAGGTGAGCCCGGCTGGGCAGGG - Exonic
1126010181 15:44295161-44295183 CACTTCAGCCCGGCGGGTGGAGG - Intronic
1126738085 15:51751710-51751732 CGGGTGAGCGCCCCGGGGGGCGG + Exonic
1128062493 15:64743629-64743651 CAGTTGTGCCCAGGGGGGGGGGG + Intronic
1128143178 15:65316494-65316516 CAGGGGAGCCCAGTCGGGGGCGG - Intergenic
1129161973 15:73752394-73752416 CAGGTGACCGGGGCGCGGGGAGG + Exonic
1129261003 15:74367297-74367319 CAGGTAAGCCTGGCAGAGGGTGG - Exonic
1129423844 15:75451200-75451222 CCGGTGCGCGCGGAGGGGGGCGG - Intronic
1129740850 15:77988861-77988883 CAGGTGAGCCGGGCTGTGGCGGG + Intronic
1130100034 15:80886302-80886324 GAGGTGAGGCTGGAGGGGGGCGG + Intronic
1130256952 15:82330161-82330183 CAGGTGAGCCAGGCTGCGGGGGG + Intergenic
1130597996 15:85259827-85259849 CAGGTGAGCCAGGCTGCGGGGGG - Intergenic
1130902212 15:88215547-88215569 CAGGGGAGCCAGGCTGGGGCTGG + Intronic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131514390 15:93067541-93067563 CAGGTGTCCCCGGCGTCGGGGGG + Intronic
1132347844 15:101119151-101119173 CAGCAGGGCCCGGCGTGGGGTGG - Intergenic
1132398113 15:101489206-101489228 CCGGGGCGCCCTGCGGGGGGGGG - Intronic
1132565477 16:620653-620675 CGGTGGAGCCCGTCGGGGGGGGG - Intronic
1132580424 16:682279-682301 CAGGTGAGGCCTGCGGCTGGGGG + Exonic
1132841185 16:1979182-1979204 CGGGTGGGCACGGTGGGGGGAGG + Exonic
1132868708 16:2106071-2106093 CAGGTGAGCCAGGCCGTGGGAGG - Exonic
1132881640 16:2164113-2164135 CAGGGGAGCTCGGTGGGGGGGGG + Intronic
1132895719 16:2228544-2228566 CAGGTGAACCCGGGAGGGGATGG - Intronic
1132942279 16:2514180-2514202 GCGGTGAGCGCGGCGGCGGGAGG + Exonic
1133015163 16:2936450-2936472 GAGGAGAGGCCAGCGGGGGGCGG - Intronic
1133049112 16:3106641-3106663 CAGGTGAGGGCGGCGGGGCGGGG + Intergenic
1133188194 16:4115460-4115482 CTGGTGACCCCGGCCGGGGCAGG - Exonic
1134036810 16:11037285-11037307 CAGGTGATCCCGAAGGTGGGTGG - Intronic
1134522877 16:14926588-14926610 CAGGTGAGCCAGGCCGTGGGAGG + Intronic
1134549750 16:15133470-15133492 CAGGTGAGCCAGGCCGTGGGAGG - Intronic
1134710545 16:16325239-16325261 CAGGTGAGCCAGGCCGTGGGAGG + Intergenic
1134718715 16:16369527-16369549 CAGGTGAGCCAGGCCGTGGGAGG + Intergenic
1134949057 16:18343406-18343428 CAGGTGAGCCAGGCCGTGGGAGG - Intergenic
1134956040 16:18382632-18382654 CAGGTGAGCCAGGCCGTGGGAGG - Intergenic
1135991855 16:27223324-27223346 TAGGTGAGGCCGGCCGGGGCTGG + Intergenic
1136237639 16:28924725-28924747 CAGGTGAGCCGGGCGGGCCCAGG - Intronic
1137426378 16:48384851-48384873 GAGGCGGGCCCGGCCGGGGGTGG - Intronic
1137502062 16:49019287-49019309 CAGATGATGCGGGCGGGGGGTGG + Intergenic
1137665337 16:50246201-50246223 CAGGTGAGCGCGGGGCGCGGGGG + Intronic
1139631730 16:68235614-68235636 CAGGTGAGCGCCGGGGTGGGTGG - Exonic
1139954344 16:70686092-70686114 CACGTGGGCGCGGCGGAGGGGGG + Intergenic
1140415611 16:74772032-74772054 CAGGTGAGCCCGGGAGGTGGAGG - Intronic
1140442533 16:74998961-74998983 AGGGTTAACCCGGCGGGGGGAGG + Intronic
1140450159 16:75064215-75064237 CAGTTGAGCCCGGGAGGTGGAGG + Intronic
1141623727 16:85250432-85250454 CTGGTGAGCCCAGCTGGGGGCGG + Intergenic
1141719914 16:85750548-85750570 GAAGGCAGCCCGGCGGGGGGCGG - Intronic
1142157704 16:88540133-88540155 GAGGTGAGCCAGGCAGGGGCAGG + Intergenic
1142565420 17:837060-837082 CACGTGAGCCCGGGTGGTGGAGG - Intronic
1142623839 17:1180219-1180241 CTGCTGAGCCCGGCGCGGGGGGG - Intronic
1142701216 17:1662183-1662205 CAGATGAGCCAGGGGCGGGGAGG + Intronic
1142764791 17:2058961-2058983 CAGGTGAGGCCGCCGAGAGGTGG - Exonic
1143140582 17:4739881-4739903 CAGGTGCGCGCGGCCGGGGCTGG - Intronic
1143617753 17:8064033-8064055 GCGGGGAGGCCGGCGGGGGGAGG - Intergenic
1143658856 17:8312638-8312660 CAGGTGAGTGTGGCGGGTGGGGG + Exonic
1143723264 17:8828498-8828520 CAGGTGGGCCTGGCGTGGGCTGG - Intronic
1143780212 17:9225379-9225401 CAGAGGAGCCCTGCGGGGTGGGG + Intronic
1144128118 17:12221142-12221164 CAGGAGCCCACGGCGGGGGGCGG - Intergenic
1144784345 17:17823588-17823610 CAGGTGAAGTCGGCGCGGGGAGG - Exonic
1145056805 17:19708282-19708304 CAGGTGAGCCCGGGGGCTGGTGG - Exonic
1145817245 17:27804387-27804409 CAGGTGGGCCCCCCGGAGGGTGG + Intronic
1146256490 17:31393889-31393911 CTGGTGGGGGCGGCGGGGGGCGG - Intronic
1146322582 17:31858738-31858760 CAGGTGAGGGCGGCGAGGAGAGG - Intronic
1146646858 17:34581709-34581731 TAGGCGAGCCCGGAGGGCGGGGG + Intronic
1146935054 17:36808195-36808217 CGGGAGAGCCGGGCGGGGAGGGG - Intergenic
1147110200 17:38256585-38256607 CAGGTGTGCTCGCCGGGGAGGGG + Intergenic
1147705479 17:42422464-42422486 CCGGTGAGCGCGGCTGGGGTGGG - Intronic
1148251552 17:46085571-46085593 CACTTGAGCCCGGGAGGGGGAGG - Intronic
1148260995 17:46183454-46183476 CACTTGAGCCTGGCGGGTGGAGG + Intronic
1148419308 17:47531834-47531856 CAGGTGTGCTCGCCGGGGAGGGG - Intronic
1148542172 17:48489402-48489424 CACTTGAGCCCGGCAGGCGGAGG + Intergenic
1148596617 17:48861298-48861320 CAGGTGAGCCCAGGAGGCGGAGG - Intronic
1148615201 17:48996289-48996311 CAGGTCAGACCCGCGGGGGGAGG - Intergenic
1148722480 17:49763872-49763894 CAGGTGAGCCGGGCCTGGAGCGG - Exonic
1148746221 17:49919922-49919944 CAGGTGAGCCTGGTGGGGGCTGG - Intergenic
1149651593 17:58279503-58279525 CAGGTGCGGCTGGCTGGGGGTGG - Exonic
1149995314 17:61403205-61403227 AAGGTGCGCGCGGCGGGCGGTGG + Exonic
1150250014 17:63700012-63700034 CTGGTGAGAGCCGCGGGGGGAGG - Exonic
1151341958 17:73477307-73477329 CAGGTCACCCCGGGGGTGGGGGG + Intronic
1151765784 17:76132587-76132609 CAGGTGACCGGGGCGGGCGGGGG - Intergenic
1151821284 17:76498251-76498273 CAGCTGAGCCAGGCTGGGGGAGG - Intronic
1152103175 17:78314459-78314481 CAGGTGGGCTCGGCTGGAGGAGG + Intergenic
1152227175 17:79097861-79097883 AAGGGGGGCCCGGCGCGGGGAGG - Intronic
1152362348 17:79838711-79838733 CCGGGGAGGCCGGCGGAGGGAGG - Intronic
1152515022 17:80817990-80818012 CAGGTGAGCCCGGAAGTGTGGGG + Intronic
1152573157 17:81129216-81129238 CAGGAGAGCCCAGGGGGAGGGGG + Intronic
1152639935 17:81445182-81445204 CAGGTGAGCGTGGCTAGGGGCGG - Intronic
1152924096 17:83079732-83079754 CCGGCGAGCCGGGCGGGGGCGGG - Exonic
1152996991 18:416853-416875 CAGGTGGGGGCGGTGGGGGGTGG + Intronic
1155071408 18:22320154-22320176 CAGGTGAGCCTGTTGGGGAGCGG + Intergenic
1156109871 18:33713339-33713361 CACTTGAACCCGGGGGGGGGTGG - Intronic
1156171650 18:34493644-34493666 CAGAGGAGCCCGCCGCGGGGCGG + Intronic
1157218030 18:45801871-45801893 CAGGAGAGCCCTGAAGGGGGTGG - Intergenic
1160523976 18:79524765-79524787 TGGGAGAGCCCGTCGGGGGGCGG - Intronic
1160577381 18:79864289-79864311 CGGGTGAGCGCGGCCGGGGGTGG + Exonic
1160824888 19:1074877-1074899 CTGGTGAGGCGGGCGGGCGGGGG + Exonic
1160834718 19:1119300-1119322 CAGCTGAGCCTGGCGGGGACGGG + Intronic
1160869995 19:1273338-1273360 TAGGGGAGCCAGGCGGGGGACGG + Intronic
1160873222 19:1286306-1286328 CAGGTGAGCGCGGCCGCGCGCGG + Exonic
1160903119 19:1438948-1438970 CGGGTGAGGGCGGCGGGGCGGGG + Intronic
1160947973 19:1652280-1652302 CAGGTGAGCCCGGCGGGGGGCGG - Exonic
1161051082 19:2164336-2164358 CCGGTGAGCGCGGCTTGGGGGGG - Intronic
1161088054 19:2344157-2344179 CAGGGGAGCACGGTGTGGGGTGG - Intronic
1161195574 19:2984344-2984366 CATCGGAGCCCCGCGGGGGGGGG - Intronic
1161204428 19:3033689-3033711 CAGGAGAGCCCCGCAGAGGGAGG - Intronic
1161273586 19:3403825-3403847 CAGCCGGGCGCGGCGGGGGGTGG - Intronic
1161313501 19:3607407-3607429 CAGGTGAGCCGGGAGGGCTGGGG + Intergenic
1161384175 19:3982226-3982248 CAGGTGAGCCCCGCGGGATATGG - Exonic
1161534331 19:4809737-4809759 CACGTGGGGCCGGCGGGCGGTGG + Intergenic
1161576703 19:5058419-5058441 GAGGGGAGCCCGGTGAGGGGAGG + Intronic
1161628266 19:5339213-5339235 CAGCTGAGCCCAGAAGGGGGAGG + Intronic
1161801407 19:6418463-6418485 CAGGTGAGCACGCCCTGGGGTGG - Exonic
1161857255 19:6773009-6773031 CAGGTGAGCCCTCCGCGGGCAGG + Exonic
1162589095 19:11578971-11578993 CAGGTGAGCCCCGGCGGGGAGGG + Exonic
1162782017 19:13011447-13011469 CAGGTGCGCCCGGGCGGTGGAGG + Intronic
1162932481 19:13963838-13963860 CAGGTGAGCGCGGGGCGGGGCGG - Exonic
1162948521 19:14057507-14057529 CCGGTGAGCCCCGCGGAGGAGGG - Intronic
1162954245 19:14089765-14089787 AAGGTGAGCGCGCCGGGGAGCGG - Exonic
1162965917 19:14156045-14156067 GAGGTGGGCCCAGCGTGGGGCGG + Intronic
1163151715 19:15418891-15418913 CAGGTGGGCCTGGCAGGGTGGGG - Exonic
1163365090 19:16871396-16871418 CAGGTGAGCCGGGCCGGGGTGGG + Exonic
1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG + Intergenic
1164889582 19:31812030-31812052 CAGGTGGGCCCGGCTGATGGTGG + Intergenic
1165432429 19:35780496-35780518 CAGGTGAGTCCAGCTGGGCGCGG + Exonic
1165479462 19:36054115-36054137 CAAGTGAGCGCAGCGCGGGGCGG - Exonic
1166365073 19:42274139-42274161 GAGGTCAGGCCGGCAGGGGGTGG - Intronic
1166515252 19:43441660-43441682 CAGTTGAACCCGGGGGGTGGAGG + Intergenic
1166811348 19:45516327-45516349 CTGGGGAGCCAGGCGAGGGGTGG + Intronic
1166947102 19:46404103-46404125 CAGGTGGGCGTGGCGGGGAGAGG + Intergenic
1166959688 19:46490017-46490039 CAGGTGGGCGTGGCGGGGAGAGG - Intronic
1167116292 19:47491112-47491134 CAGCTGAGCCAGGTGGGAGGAGG - Intronic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
1167962200 19:53115043-53115065 CAGGAGAGACCGGCCGGGCGCGG + Intronic
1168713906 19:58516375-58516397 CGGGTGAGCCAGGGCGGGGGAGG - Exonic
1168717666 19:58538793-58538815 CAGGTGACAACGGCTGGGGGCGG - Intronic
926113577 2:10197324-10197346 CAGGAGAGCCAGGCAGGGAGAGG - Intronic
926243231 2:11103733-11103755 GAGGTGAGCCCGGCTGGGGTGGG + Intergenic
927990344 2:27442774-27442796 CAGGCGACCCGGGCGGGGGCCGG + Intronic
928261135 2:29767757-29767779 CAGGTGTGCCAGGCAGGGGGAGG - Intronic
928511969 2:32010681-32010703 GCGGGGAGCCCCGCGGGGGGTGG - Intronic
929587881 2:43127431-43127453 CAGGAGAGCCTGGCTGGGCGGGG - Intergenic
929778596 2:44943435-44943457 CAGGAGAGCCGGGCTGGGAGTGG + Intronic
931434467 2:62234977-62234999 CAGGAGAGCCAGGGCGGGGGTGG + Intergenic
932688614 2:73893906-73893928 CAGGTGAGGCAGGCTGGGTGTGG + Intronic
933133459 2:78701793-78701815 CTGGTGAGGCCGGGGGGGCGGGG + Intergenic
933816216 2:86070696-86070718 CATGTGATCACGGCGGGGGGGGG - Intronic
933858562 2:86441847-86441869 CGGGGGAGGGCGGCGGGGGGCGG + Intronic
933996571 2:87674447-87674469 CACGTGAGCCGGGAGGTGGGAGG - Intergenic
934695481 2:96397035-96397057 CACCTGAGCCCGGGAGGGGGAGG + Intergenic
937039183 2:118807854-118807876 CAGGAGAGCCCAGCGGGCTGCGG + Intergenic
937270954 2:120652295-120652317 GAGCTGAGCCCGGCTGGAGGTGG + Intergenic
937375995 2:121336014-121336036 CAGGTGTGCCTGTCGGGGGGGGG + Intergenic
937927398 2:127177572-127177594 CAGAGGCGCACGGCGGGGGGTGG - Intergenic
938296497 2:130182450-130182472 CAAGTGAGCGGGGCGGGTGGGGG + Exonic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
938460254 2:131492187-131492209 CAAGTGAGCGGGGCGGGTGGGGG - Exonic
938639536 2:133265600-133265622 CTGGTGAGCTGGGCGGGAGGTGG + Intronic
938956001 2:136298914-136298936 CAGTTCAGCCCGGAGTGGGGCGG + Intergenic
940323573 2:152401987-152402009 CATGTGAGCCCGGGAGGCGGAGG - Intronic
940774934 2:157875860-157875882 CAGGTCGGCGCGGCGCGGGGCGG + Intronic
940883430 2:158968929-158968951 CGGGTGTGCCCGGCGGAGGAGGG - Intronic
943580803 2:189681721-189681743 CAGGTGATCCCTGGGGAGGGAGG + Intronic
943752001 2:191519430-191519452 TTGTTGAGCCCGGCAGGGGGAGG - Intergenic
943988013 2:194647396-194647418 CACTTGAACCCGGCAGGGGGAGG + Intergenic
945305508 2:208255267-208255289 CCGGTGATCCCGGTGGGGGAAGG + Intronic
946329597 2:219001894-219001916 CAGGAAAGCCGGGCGGAGGGTGG - Intergenic
946843256 2:223837819-223837841 CAGGTGCGGCCGGCTCGGGGCGG - Intronic
947907768 2:233778038-233778060 CATGTGAGCCCTGGGTGGGGAGG - Intronic
948945842 2:241218379-241218401 CAGGTGAGCCCCGCGCCAGGTGG + Exonic
948992472 2:241561895-241561917 CAGGGGAGCCCGACGTGGGGAGG - Intronic
1168831005 20:845272-845294 CAGGCGAGGCGGGCAGGGGGCGG - Exonic
1168913705 20:1469494-1469516 GAGATGAGCCCGGAGGGGGCTGG - Intronic
1169193938 20:3673554-3673576 ACGGTGAGCCCCGCGGGCGGGGG - Exonic
1169275475 20:4230880-4230902 CAGCTGAGCCAGGCTGGGTGGGG - Intronic
1169446137 20:5672447-5672469 CAGGTGAGGCCGGGGGTGTGGGG + Intergenic
1170204687 20:13785288-13785310 GAGGTGAGCCCGCGGGGCGGCGG + Exonic
1170593962 20:17791811-17791833 CCCTTGGGCCCGGCGGGGGGTGG + Intergenic
1171223203 20:23420484-23420506 CAGGTGGGCCCCGCCGGGGAGGG - Intronic
1171361615 20:24590264-24590286 CAGGTGGGGCCGGCGCGGCGGGG + Intronic
1172271952 20:33659865-33659887 CAGGTGCGCCTGGGGTGGGGTGG - Exonic
1172669866 20:36627540-36627562 GAGGTGAGCCCTGCAGGGGCAGG + Intronic
1173472720 20:43336274-43336296 CGGGTGAGACCGGCTGGGGCTGG - Intergenic
1173750106 20:45469858-45469880 CAGGTGAGTGGGGCGGGGAGAGG + Exonic
1174357845 20:50010158-50010180 AACGTGAGCCGGGCTGGGGGCGG + Intergenic
1175264620 20:57695212-57695234 CAGGTGAGGCGGGCAGGCGGTGG + Intronic
1175549722 20:59809204-59809226 CAGGTGAGGCCGGCCCGGGGTGG + Intronic
1175813017 20:61868864-61868886 CAGGTGTGCCCGGCTGGGATGGG - Intronic
1175862864 20:62159490-62159512 CAGCTGAGCCAGGCAGTGGGCGG - Intronic
1175949560 20:62576151-62576173 GAGGTGAGCTCCGCGAGGGGCGG + Intergenic
1176030613 20:63009471-63009493 CAGGTGAGCCTGGGGGGTTGAGG + Intergenic
1176061581 20:63175076-63175098 CAGGTGGCTCCGGCGGGGGCGGG - Intergenic
1176286228 21:5020837-5020859 CAGGTGAGCCGGGCGGGCTGCGG - Intergenic
1176286688 21:5022453-5022475 CAGAGGAGCCAGGCCGGGGGCGG + Intergenic
1176524804 21:7857975-7857997 CAGGTGAGCCAGGTGTGGAGTGG + Intergenic
1176550088 21:8217180-8217202 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176569015 21:8400215-8400237 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1176576929 21:8444450-8444472 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1178538129 21:33427221-33427243 CAGATCAGCCTGGCGGAGGGAGG - Intronic
1178658824 21:34487988-34488010 CAGGTGAGCCAGGTGTGGAGTGG + Intergenic
1179475753 21:41642631-41642653 GAGGTGAGACTGTCGGGGGGCGG + Intergenic
1179552399 21:42151377-42151399 CAGGTGAGATCTGCTGGGGGAGG + Intergenic
1179553567 21:42158902-42158924 AAGGTGAGGCTGGCGGGGTGGGG - Intergenic
1179641707 21:42752025-42752047 CAGGTGGGCCGGGCCGGGTGCGG - Intronic
1179870493 21:44241022-44241044 CAGAGGAGCCAGGCCGGGGGCGG - Intergenic
1179870953 21:44242638-44242660 CAGGTGAGCCGGGCGGGCTGCGG + Intergenic
1180177588 21:46098057-46098079 CGGGTCAGGCCGGCGGGGCGGGG + Intergenic
1180867440 22:19127474-19127496 CAGGTAAGCCCGGGTGGGAGGGG + Intergenic
1180970996 22:19815534-19815556 CATGTAAGCCCTGCGGGGAGTGG + Intronic
1181005250 22:20010374-20010396 CTGGTGGGCCTGGCGGGTGGGGG - Intronic
1181050853 22:20237602-20237624 CTGCTGTGCCCGGCGGGGTGGGG + Intergenic
1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG + Intergenic
1182096818 22:27631033-27631055 CAGGCGAGCAGGGCGGGGGGTGG + Intergenic
1183241440 22:36660636-36660658 CAGGTGAGGCGGGCGGGGCGGGG + Intronic
1183742615 22:39677307-39677329 CAGGTGAGGCCGGGTGGGGCTGG - Intronic
1184337564 22:43862638-43862660 TGGGTGACCCCGGCCGGGGGCGG - Intergenic
1184391830 22:44207369-44207391 CGGGTGAGGCTGGCGGGGAGGGG + Exonic
1184391845 22:44207406-44207428 CGGGTGAGGCTGGCGGGGAGGGG + Exonic
1184452544 22:44591603-44591625 CAGGACAGCCCGGCAGGGTGCGG - Intergenic
1184525594 22:45020728-45020750 CAGGTGAGCCGGGGGGAGTGAGG + Intergenic
1185244881 22:49768281-49768303 CGGGCGAGCCAGGTGGGGGGTGG - Intergenic
1185360368 22:50403326-50403348 CCGGTGAGCTGGGCAGGGGGAGG - Intronic
1185409575 22:50674761-50674783 CGGGCGCGCCCGGCGGGGGTGGG - Intergenic
1203254978 22_KI270733v1_random:133506-133528 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203263034 22_KI270733v1_random:178585-178607 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
950872376 3:16240870-16240892 CAGGTGAGTCCAGAGGGTGGAGG - Intergenic
951907749 3:27721394-27721416 CAGGTGAGCGCAGCGTGGAGGGG - Exonic
954110341 3:48429733-48429755 CAGGTGAGGCCGACGGGGCGGGG - Intronic
954249633 3:49358007-49358029 CAGGTGCGCCGGGCGGAGCGGGG - Exonic
954747447 3:52795215-52795237 CAGTTGAGCCCTGCGGGGTGTGG + Intronic
955188014 3:56733318-56733340 GAGGTGGGCGGGGCGGGGGGGGG + Intronic
955554238 3:60118761-60118783 GAGGTGGGGGCGGCGGGGGGGGG + Intronic
955793098 3:62608364-62608386 CACGTGAGCCCGGGAGGTGGAGG - Intronic
960537342 3:118828344-118828366 CAGGTCAGCCCAGCAGCGGGAGG + Intergenic
961081787 3:124033811-124033833 CAGGTAAGCCGGGCAGGGCGCGG + Intergenic
961319199 3:126061332-126061354 CAGGCCAGCCTGGCAGGGGGTGG - Intronic
961450874 3:127001763-127001785 CAGGTGTGCCAGGCGGGAGCAGG - Intronic
961492149 3:127263628-127263650 CAGGTGTGCTGGGTGGGGGGTGG - Intergenic
961550479 3:127668146-127668168 CAGTTGAGCGGGGCGGGGGCTGG - Intronic
961665862 3:128492834-128492856 CAGGCGGGCCGGGCCGGGGGCGG + Intronic
961698983 3:128726738-128726760 CGGGTGGGCACGGCGGCGGGCGG - Intronic
961933725 3:130561265-130561287 CAGGGGAGCCCTGCCGTGGGTGG - Intronic
962613456 3:137101108-137101130 CACTTGAGCCCTGCAGGGGGAGG + Intergenic
966866058 3:184259825-184259847 CAGGGGAGCCGTGCGGGAGGGGG + Exonic
967904015 3:194486546-194486568 CCGGTGAGCGGGGCGAGGGGCGG - Intronic
968497490 4:926833-926855 CAGGTGAGCTGGGAGGGGTGCGG - Intronic
968497516 4:926912-926934 CTGGTGAGCCGGGAGGGGTGCGG - Intronic
968497526 4:926949-926971 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497538 4:926986-927008 CTGGTGAGCCGGGAGGGGTGCGG - Intronic
968497548 4:927023-927045 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497569 4:927097-927119 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497581 4:927134-927156 CAGGTGAGCCGGGAGGGGTGTGG - Intronic
968497592 4:927171-927193 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497603 4:927208-927230 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497616 4:927245-927267 CAGGTGAGCCGGGAGGGGTGTGG - Intronic
968497626 4:927282-927304 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497638 4:927319-927341 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497648 4:927356-927378 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497660 4:927393-927415 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497670 4:927430-927452 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497682 4:927467-927489 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497689 4:927494-927516 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497702 4:927531-927553 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497713 4:927568-927590 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497724 4:927605-927627 CAGGTGAGCCGGGAGGGGTGCGG - Intronic
968497734 4:927642-927664 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968497745 4:927679-927701 CAGGTGAGCGGGGAGGGGTGCGG - Intronic
968519645 4:1029695-1029717 CAGGAGGGCCGGGCGGGGGCGGG - Intergenic
968662433 4:1804272-1804294 CATGGGAGCCCCGTGGGGGGGGG + Intronic
968753185 4:2401063-2401085 CAGGTGAGCACAGTGGGGGATGG + Intronic
968905146 4:3447431-3447453 GAGGTGAGCCCGGTGGCTGGGGG + Intronic
968908047 4:3463549-3463571 CAGGTGAGCGGGGCGGGCGGGGG + Exonic
969053123 4:4386641-4386663 CAGGTGAGCGCGGCGCGCTGCGG + Exonic
969285594 4:6200223-6200245 CAGGTGCGCCGGGGGGCGGGAGG - Intronic
969412485 4:7038445-7038467 CAGTTGAGCCCAGGGGGTGGAGG - Intergenic
969621206 4:8279819-8279841 GAGAGGAGCCCGGCGTGGGGTGG - Intronic
969714273 4:8860941-8860963 CAGGTGAGCCGGGCGGGGGCGGG + Intronic
973001030 4:44951108-44951130 CGCTTGAGCCCGGCAGGGGGAGG - Intergenic
975125657 4:70779664-70779686 CACTTGAGCCCGGGGGGCGGGGG - Intronic
977569284 4:98612822-98612844 GAGGTTAGCCCTGTGGGGGGAGG - Intronic
978552174 4:109939337-109939359 CAGCTGAGCCAGGCAGGGGAGGG + Intronic
978741845 4:112145731-112145753 CAGGTGAGCGCGGGGAGGGGCGG + Exonic
980037805 4:127905218-127905240 CATGGGAGCATGGCGGGGGGAGG - Intergenic
981723604 4:147825361-147825383 CAGTTGAGCCCGGGAGGCGGAGG + Intronic
982033528 4:151324754-151324776 CTGGTGAGCTCGGCGGCTGGGGG + Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984029191 4:174582390-174582412 CACTTGAGCCTGGCGGGTGGAGG - Intergenic
984735103 4:183100138-183100160 TAGCAGGGCCCGGCGGGGGGCGG - Intronic
984762656 4:183376497-183376519 TGGGTGAGCCGGGCGGGGCGGGG - Intergenic
985472512 5:54437-54459 CCCGTGGGCCCGGCGGTGGGGGG - Intergenic
985724703 5:1509914-1509936 CAGGTGAGGCCTGCAGGAGGAGG + Intronic
985761837 5:1752961-1752983 CAGGACAGCCAGGCGGTGGGAGG + Intergenic
985871998 5:2564374-2564396 CAGGGGAGCACGGCGGCTGGTGG + Intergenic
987099833 5:14581956-14581978 CAGGTGAGCCTGGGGCCGGGCGG + Exonic
989368237 5:40679777-40679799 CAGGGAAGACTGGCGGGGGGCGG - Exonic
994363344 5:98881591-98881613 CAGTTGAGCCCGGGAGGCGGAGG - Intronic
995264380 5:110140323-110140345 CATGGGAGCCAGTCGGGGGGTGG + Intergenic
995751854 5:115460394-115460416 CAGGAGAGCCCAGATGGGGGTGG - Intergenic
996360709 5:122642616-122642638 CAGGTGAACCCGGGAGGCGGAGG - Intergenic
998366693 5:141636955-141636977 GAGCTGAGCCGGGCGAGGGGCGG - Intronic
998583394 5:143403421-143403443 CCGCGGAGCCCGGCGCGGGGCGG - Exonic
999330650 5:150671691-150671713 AAGGGGAGCGCGGCTGGGGGCGG + Intronic
999400449 5:151259914-151259936 AAGGTGAGCCTGGGGGTGGGTGG + Exonic
1002140112 5:177133152-177133174 CAGGTGAGCCCTGCGGCAGGAGG + Intronic
1002169532 5:177367372-177367394 CAGGTGAGCCGGGGCTGGGGTGG - Intronic
1002435810 5:179230154-179230176 GAGGTGGTCCCGGCGGGAGGAGG + Intronic
1002567155 5:180118647-180118669 CAGGACAGCCCTGCGCGGGGCGG - Exonic
1003330661 6:5125619-5125641 CAGCTGAGCCTGGCAGAGGGAGG + Intronic
1004009065 6:11663920-11663942 TAGGGGAGGCGGGCGGGGGGCGG + Intergenic
1004044635 6:12012259-12012281 CAGGGGAGCGGGCCGGGGGGCGG - Intronic
1004250346 6:14018276-14018298 CAGGAGCCCACGGCGGGGGGTGG - Intergenic
1005114238 6:22318498-22318520 CAGGGGAGCCCACCGGGGGTGGG + Intergenic
1006152460 6:31996738-31996760 CAGGAGAGCCCAGCAGGGGGTGG + Intronic
1006158766 6:32029475-32029497 CAGGAGAGCCCAGCAGGGGGTGG + Intronic
1006217742 6:32459800-32459822 GAGGTGAGCAAGGCGGGTGGGGG - Intergenic
1006224093 6:32521885-32521907 GAGGTGAGCATGGTGGGGGGCGG - Exonic
1007099998 6:39239635-39239657 CAGGGGAGGCAGGCTGGGGGAGG - Intergenic
1011120092 6:83942760-83942782 CACTTGAGCCTGGTGGGGGGAGG + Intronic
1015559640 6:134500801-134500823 CACTTGAGCCCGGCAGGCGGAGG + Intergenic
1015793766 6:136990024-136990046 CAGGGGAGCGGGGCGGAGGGCGG - Intergenic
1018324283 6:162648463-162648485 CACTTGAACCCGGCGGGCGGAGG - Intronic
1019428116 7:986853-986875 CAGGGGAGCACGGCTGGGGAGGG + Intronic
1019541020 7:1551040-1551062 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541048 7:1551122-1551144 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541088 7:1551242-1551264 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541115 7:1551324-1551346 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541143 7:1551406-1551428 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019611892 7:1940955-1940977 AGGGTGAGGCCTGCGGGGGGAGG - Intronic
1019735200 7:2647020-2647042 CAGGTGAGCGCGGTGGGGCGGGG + Exonic
1019925814 7:4191242-4191264 CATGTGACCGCGGCGGGGGAGGG - Intronic
1020083965 7:5300660-5300682 CAGGTGAGGCCCGCGGGACGTGG + Exonic
1020117099 7:5482022-5482044 CAGGTGAGCCCGGGACGGGGAGG - Intronic
1020292089 7:6730003-6730025 CAGGGGAACCGGGCGGGAGGTGG + Intergenic
1020660355 7:10974125-10974147 CAGGCGAGGCCGGGGGGGCGGGG + Exonic
1021162923 7:17298628-17298650 CCGGTGCGCGCGGCGGCGGGAGG + Exonic
1021450273 7:20778040-20778062 CAGGCGAGCGGGGCGGGGGGAGG + Intergenic
1022310694 7:29194147-29194169 CTCGAGAGCCCGGCGGGGCGCGG + Intronic
1023196371 7:37643994-37644016 CAGGTGAGCATGGCTGGTGGTGG - Intergenic
1023810291 7:43906418-43906440 CTGGTGGGCCTGGCGGGCGGGGG + Intronic
1025943369 7:66089173-66089195 CGGGTGAGCAAGGCAGGGGGAGG + Exonic
1025990158 7:66491544-66491566 CACTTGAACCCGGCAGGGGGCGG + Intergenic
1026050019 7:66938589-66938611 CAGTTGAACCCGGAGGGCGGAGG - Intronic
1028984049 7:96996199-96996221 CAGCTGAGCGTGGCGGGGGCGGG + Intergenic
1029432299 7:100539252-100539274 CAGGGGAGCCGGGCGTGCGGAGG + Exonic
1029673379 7:102049332-102049354 CAGCTCAGCCCGGAGGGGAGAGG + Intronic
1029746357 7:102517626-102517648 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1029764295 7:102616605-102616627 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1030584671 7:111403000-111403022 CACCTGAGCCTGGCGGGGTGGGG - Intronic
1032387487 7:131534513-131534535 CAGGGGTGGCCGGCGGGGGTAGG + Intronic
1032387807 7:131536656-131536678 CAGGTGAGCCTCCCAGGGGGAGG - Intronic
1033389699 7:140914954-140914976 CACTTGAACCCGGGGGGGGGGGG + Intronic
1034640879 7:152601493-152601515 CAGGCGGCCCCGGCGTGGGGGGG - Intergenic
1034977944 7:155458778-155458800 CATGTGCGCCCGGCGCGGGCGGG + Exonic
1035223260 7:157419121-157419143 CTGGGGGGCCCTGCGGGGGGTGG + Intergenic
1035265967 7:157690524-157690546 CAGGGGTGCCGGGCGGGGCGCGG - Intronic
1035385320 7:158468480-158468502 CAGCTGAGGGCGGCGAGGGGCGG - Intronic
1035602079 8:902776-902798 CAGGTGGGCGGGGCCGGGGGAGG + Intergenic
1035870251 8:3129895-3129917 CACCTGAGCCCGGGGGGCGGAGG + Intronic
1036708059 8:11059671-11059693 CAGGTGCGGCGGGCGCGGGGCGG + Intronic
1036756848 8:11476773-11476795 CATGTGAGCCGGGGTGGGGGAGG + Intergenic
1037816865 8:22117020-22117042 GAGGTGTGCCCGGCCGGGGCAGG - Exonic
1038304112 8:26383517-26383539 CAGCGGAGCCGGGCGGGGCGGGG + Intronic
1038828711 8:31033713-31033735 AAGGCGAGCCGGGCCGGGGGCGG + Exonic
1039484410 8:37899631-37899653 CTGCTGAGGCCGGCGGGGCGGGG - Intergenic
1042859234 8:73295803-73295825 CTGGGGACCACGGCGGGGGGAGG + Intronic
1042902906 8:73746576-73746598 GAGGGGAGACCGGCGGGGGAGGG - Intronic
1043395020 8:79827616-79827638 GAGGGGAGGCCGGCGGTGGGTGG - Intergenic
1045498553 8:102728368-102728390 CAGGTGAGTGGGGCGGGGAGGGG + Intergenic
1047100157 8:121667526-121667548 CAGGAGCCCCCGGCGGGGGCGGG + Intergenic
1049181923 8:141227307-141227329 GAGGGGAGACTGGCGGGGGGTGG + Intronic
1049610991 8:143555260-143555282 CAGGTCAGCCAGGCAGGGTGGGG + Intronic
1049755829 8:144310959-144310981 CAGGTGTCCCCGGCAGGGAGGGG + Intronic
1049812251 8:144580768-144580790 CAGGTGAGGCAGGTAGGGGGTGG - Intronic
1049843204 8:144787253-144787275 AGTGTGAGCCCGGCGGGGGCGGG - Intronic
1052139103 9:24955555-24955577 CACTTGAGCTCAGCGGGGGGAGG + Intergenic
1052494737 9:29212497-29212519 CAGGTGAGCCTGGCGCAGGTGGG - Intergenic
1053284637 9:36842286-36842308 CAGGTGAGCCCAGAGGAAGGCGG + Intronic
1053850829 9:42288256-42288278 CAGGTGGGGCGGGCGGTGGGTGG - Intergenic
1054573214 9:66831729-66831751 CAGGTGGGGCGGGCGGTGGGTGG + Intergenic
1056643248 9:88388536-88388558 CAGGTGAGGCCCGCGCAGGGCGG + Exonic
1057013306 9:91627943-91627965 CAGGTATGCCCGGGGTGGGGGGG - Intronic
1057426023 9:94950489-94950511 CAGGTGAGACCTGCAGGGGAAGG - Intronic
1057613318 9:96566748-96566770 AAGGTGAGCCGGGAGGGCGGGGG - Intronic
1057619139 9:96619512-96619534 CGGCAGAGCCCGGCGGGAGGCGG + Exonic
1057882997 9:98807591-98807613 CAGGTGGGGCGGGCCGGGGGCGG + Intergenic
1060256549 9:122035880-122035902 CAGGTGAGCAGGGCAGGGGAGGG - Intronic
1060550850 9:124484668-124484690 CAGGTGAACCCGGGAGGTGGTGG + Intronic
1061076672 9:128345547-128345569 CAGGTGAGCCCCAAGGGGGCGGG + Exonic
1061108880 9:128552803-128552825 CAGGTGAGCCGGGCGGGCCGCGG + Intronic
1061137541 9:128743812-128743834 CACTTGAGCCCGGGAGGGGGAGG - Intronic
1061196928 9:129111629-129111651 CAGGTAAGGCCGGCGGGGCCAGG + Exonic
1061272265 9:129550203-129550225 CCGGCGAGCCGGGCGGGGAGAGG - Intergenic
1061451314 9:130668351-130668373 CCGGTAAACCCGGCGGGGGGAGG + Intronic
1061941592 9:133887008-133887030 CAGGAGGGCCCGGGGTGGGGAGG - Intronic
1062133322 9:134912075-134912097 CAGGTGAGTGCGGCTGTGGGGGG + Intronic
1062305478 9:135904313-135904335 CACTTGAGCCCGGCAGGCGGAGG + Intronic
1062401866 9:136376329-136376351 CAGGTGAGTCCTGAGTGGGGAGG - Exonic
1062462143 9:136666451-136666473 CAGGGGTGCCGGGCGGGGAGGGG - Intronic
1062579161 9:137221969-137221991 CAGGTGAGCGCAGGGGGCGGGGG - Intergenic
1062617605 9:137405058-137405080 CAGGTGAGCCAGGGGCTGGGAGG + Intronic
1062621338 9:137423704-137423726 CGGGTGAGCGGGGCGTGGGGAGG + Exonic
1203471380 Un_GL000220v1:116652-116674 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1203479201 Un_GL000220v1:160624-160646 CCGGGGAGCCCGGCGGGCGCCGG + Intergenic
1186466084 X:9785892-9785914 CAGGTGAGATGGGCGCGGGGTGG - Intronic
1187443966 X:19344322-19344344 CAGCTGGGCCCGGGGGCGGGAGG - Intronic
1187573744 X:20532318-20532340 CATGTGAGCCCAGGGGTGGGTGG + Intergenic
1190024800 X:46912973-46912995 CTGGTGGCCCGGGCGGGGGGCGG + Intronic
1190102984 X:47536912-47536934 CACTTGAGCCCGGGAGGGGGAGG + Intergenic
1190829104 X:54044471-54044493 GAGGTGAGCGCGGCGGAGGCGGG + Intronic
1195217127 X:102712954-102712976 CCGGCGAGGCCGGCGGGGGTCGG + Intronic
1197761778 X:130033163-130033185 CACTTGAGCCCGGGAGGGGGAGG - Intronic
1199617527 X:149669623-149669645 CAGTTGAACCCGGCGGGGAGCGG + Intergenic
1199625116 X:149733626-149733648 CAGTTGAACCCGGCGGGGAGCGG - Intergenic
1200084807 X:153598942-153598964 CAGGTAACCGCGGCCGGGGGAGG - Exonic
1200092942 X:153644270-153644292 CCGGGGCGCCCGGCGGGGGCGGG + Intronic