ID: 1160948359

View in Genome Browser
Species Human (GRCh38)
Location 19:1653809-1653831
Sequence CGCTTTCACCCGAAAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160948355_1160948359 9 Left 1160948355 19:1653777-1653799 CCTAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1160948359 19:1653809-1653831 CGCTTTCACCCGAAAGGCGGAGG No data
1160948353_1160948359 17 Left 1160948353 19:1653769-1653791 CCTGTAGTCCTAGCTACTCGGGA 0: 1487
1: 63433
2: 190441
3: 271824
4: 186953
Right 1160948359 19:1653809-1653831 CGCTTTCACCCGAAAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160948359 Original CRISPR CGCTTTCACCCGAAAGGCGG AGG Intergenic
No off target data available for this crispr