ID: 1160949323

View in Genome Browser
Species Human (GRCh38)
Location 19:1658023-1658045
Sequence TGCCCCCGCCTCGGGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160949323_1160949332 -9 Left 1160949323 19:1658023-1658045 CCAGTTACCCCGAGGCGGGGGCA No data
Right 1160949332 19:1658037-1658059 GCGGGGGCAGGGCAGGGGACAGG No data
1160949323_1160949333 -8 Left 1160949323 19:1658023-1658045 CCAGTTACCCCGAGGCGGGGGCA No data
Right 1160949333 19:1658038-1658060 CGGGGGCAGGGCAGGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160949323 Original CRISPR TGCCCCCGCCTCGGGGTAAC TGG (reversed) Intergenic
No off target data available for this crispr