ID: 1160950766

View in Genome Browser
Species Human (GRCh38)
Location 19:1666138-1666160
Sequence GCATGTGCCCTGCACCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160950754_1160950766 30 Left 1160950754 19:1666085-1666107 CCAGGGGCACGGGAGGAATCCAG No data
Right 1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG No data
1160950759_1160950766 11 Left 1160950759 19:1666104-1666126 CCAGGGGACACAGCAAACTGGAG No data
Right 1160950766 19:1666138-1666160 GCATGTGCCCTGCACCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160950766 Original CRISPR GCATGTGCCCTGCACCTGGC CGG Intergenic
No off target data available for this crispr