ID: 1160951278

View in Genome Browser
Species Human (GRCh38)
Location 19:1668844-1668866
Sequence CAGAGTTTCAAATGCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160951278_1160951284 2 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951284 19:1668869-1668891 GGCAGAGGCCAGGGGAATCCCGG No data
1160951278_1160951285 3 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951285 19:1668870-1668892 GCAGAGGCCAGGGGAATCCCGGG No data
1160951278_1160951283 -6 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951283 19:1668861-1668883 ACTCTGCAGGCAGAGGCCAGGGG No data
1160951278_1160951286 6 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951286 19:1668873-1668895 GAGGCCAGGGGAATCCCGGGTGG No data
1160951278_1160951295 26 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951295 19:1668893-1668915 TGGAGGAGCAGGCAGGGTGAGGG No data
1160951278_1160951282 -7 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951282 19:1668860-1668882 AACTCTGCAGGCAGAGGCCAGGG No data
1160951278_1160951281 -8 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951281 19:1668859-1668881 AAACTCTGCAGGCAGAGGCCAGG No data
1160951278_1160951287 9 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951287 19:1668876-1668898 GCCAGGGGAATCCCGGGTGGAGG No data
1160951278_1160951290 19 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951290 19:1668886-1668908 TCCCGGGTGGAGGAGCAGGCAGG No data
1160951278_1160951292 20 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951292 19:1668887-1668909 CCCGGGTGGAGGAGCAGGCAGGG No data
1160951278_1160951294 25 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951294 19:1668892-1668914 GTGGAGGAGCAGGCAGGGTGAGG No data
1160951278_1160951289 15 Left 1160951278 19:1668844-1668866 CCTTACAGGCATTTGAAACTCTG No data
Right 1160951289 19:1668882-1668904 GGAATCCCGGGTGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160951278 Original CRISPR CAGAGTTTCAAATGCCTGTA AGG (reversed) Intergenic
No off target data available for this crispr