ID: 1160952032

View in Genome Browser
Species Human (GRCh38)
Location 19:1672245-1672267
Sequence ACCCCTGGCGTCCCGAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160952032_1160952047 26 Left 1160952032 19:1672245-1672267 CCCCCGCTCGGGACGCCAGGGGT No data
Right 1160952047 19:1672294-1672316 CCCCAAACTCGGGCGCGTCATGG No data
1160952032_1160952042 15 Left 1160952032 19:1672245-1672267 CCCCCGCTCGGGACGCCAGGGGT No data
Right 1160952042 19:1672283-1672305 TCGCCAGACTCCCCCAAACTCGG No data
1160952032_1160952049 27 Left 1160952032 19:1672245-1672267 CCCCCGCTCGGGACGCCAGGGGT No data
Right 1160952049 19:1672295-1672317 CCCAAACTCGGGCGCGTCATGGG No data
1160952032_1160952043 16 Left 1160952032 19:1672245-1672267 CCCCCGCTCGGGACGCCAGGGGT No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160952032 Original CRISPR ACCCCTGGCGTCCCGAGCGG GGG (reversed) Intergenic