ID: 1160952043

View in Genome Browser
Species Human (GRCh38)
Location 19:1672284-1672306
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160952041_1160952043 1 Left 1160952041 19:1672260-1672282 CCAGGGGTGGGGGACACGGAGCT No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data
1160952033_1160952043 15 Left 1160952033 19:1672246-1672268 CCCCGCTCGGGACGCCAGGGGTG No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data
1160952036_1160952043 13 Left 1160952036 19:1672248-1672270 CCGCTCGGGACGCCAGGGGTGGG No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data
1160952028_1160952043 22 Left 1160952028 19:1672239-1672261 CCGCGGCCCCCGCTCGGGACGCC No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data
1160952032_1160952043 16 Left 1160952032 19:1672245-1672267 CCCCCGCTCGGGACGCCAGGGGT No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data
1160952034_1160952043 14 Left 1160952034 19:1672247-1672269 CCCGCTCGGGACGCCAGGGGTGG No data
Right 1160952043 19:1672284-1672306 CGCCAGACTCCCCCAAACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160952043 Original CRISPR CGCCAGACTCCCCCAAACTC GGG Intergenic