ID: 1160955730

View in Genome Browser
Species Human (GRCh38)
Location 19:1690968-1690990
Sequence TGGAGGGGCGCTGCCTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160955730_1160955746 28 Left 1160955730 19:1690968-1690990 CCACACAAGGCAGCGCCCCTCCA No data
Right 1160955746 19:1691019-1691041 TCGTCAGTTGCCTCCACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160955730 Original CRISPR TGGAGGGGCGCTGCCTTGTG TGG (reversed) Intergenic
No off target data available for this crispr