ID: 1160957136

View in Genome Browser
Species Human (GRCh38)
Location 19:1698930-1698952
Sequence TGCCCCATGGGCCGCGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160957128_1160957136 10 Left 1160957128 19:1698897-1698919 CCTATCTCCCATGGAAGGACCCA No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957119_1160957136 30 Left 1160957119 19:1698877-1698899 CCCGCCCGCCGCCCGGCACTCCT No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957132_1160957136 -10 Left 1160957132 19:1698917-1698939 CCAGTTCCTGAATTGCCCCATGG No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957120_1160957136 29 Left 1160957120 19:1698878-1698900 CCGCCCGCCGCCCGGCACTCCTA No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957129_1160957136 3 Left 1160957129 19:1698904-1698926 CCCATGGAAGGACCCAGTTCCTG No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957126_1160957136 18 Left 1160957126 19:1698889-1698911 CCGGCACTCCTATCTCCCATGGA No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957122_1160957136 25 Left 1160957122 19:1698882-1698904 CCGCCGCCCGGCACTCCTATCTC No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957124_1160957136 19 Left 1160957124 19:1698888-1698910 CCCGGCACTCCTATCTCCCATGG No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957130_1160957136 2 Left 1160957130 19:1698905-1698927 CCATGGAAGGACCCAGTTCCTGA No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957131_1160957136 -9 Left 1160957131 19:1698916-1698938 CCCAGTTCCTGAATTGCCCCATG No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957123_1160957136 22 Left 1160957123 19:1698885-1698907 CCGCCCGGCACTCCTATCTCCCA No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data
1160957121_1160957136 26 Left 1160957121 19:1698881-1698903 CCCGCCGCCCGGCACTCCTATCT No data
Right 1160957136 19:1698930-1698952 TGCCCCATGGGCCGCGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160957136 Original CRISPR TGCCCCATGGGCCGCGCCGC AGG Intergenic