ID: 1160961869

View in Genome Browser
Species Human (GRCh38)
Location 19:1725724-1725746
Sequence GGGCGCATGCGCGGGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160961862_1160961869 -7 Left 1160961862 19:1725708-1725730 CCTCCGGGCCGCGCGGGGGCGCA No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961859_1160961869 -4 Left 1160961859 19:1725705-1725727 CCCCCTCCGGGCCGCGCGGGGGC No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961854_1160961869 1 Left 1160961854 19:1725700-1725722 CCGAGCCCCCTCCGGGCCGCGCG No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961853_1160961869 5 Left 1160961853 19:1725696-1725718 CCGGCCGAGCCCCCTCCGGGCCG No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961861_1160961869 -6 Left 1160961861 19:1725707-1725729 CCCTCCGGGCCGCGCGGGGGCGC No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961863_1160961869 -10 Left 1160961863 19:1725711-1725733 CCGGGCCGCGCGGGGGCGCATGC No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data
1160961860_1160961869 -5 Left 1160961860 19:1725706-1725728 CCCCTCCGGGCCGCGCGGGGGCG No data
Right 1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160961869 Original CRISPR GGGCGCATGCGCGGGGCCGC GGG Intergenic
No off target data available for this crispr