ID: 1160962443

View in Genome Browser
Species Human (GRCh38)
Location 19:1729539-1729561
Sequence CAGTGTGTGTGAGTGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160962440_1160962443 22 Left 1160962440 19:1729494-1729516 CCGGTGTGAGGGTGTGTGTGTAT No data
Right 1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160962443 Original CRISPR CAGTGTGTGTGAGTGGCAGA AGG Intergenic
No off target data available for this crispr