ID: 1160964694

View in Genome Browser
Species Human (GRCh38)
Location 19:1741950-1741972
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160964694_1160964702 -8 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964702 19:1741965-1741987 CAGCTGGGAGATGGGAGAGCTGG No data
1160964694_1160964706 22 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964706 19:1741995-1742017 ACCTGGACTCAATCCCCAGCGGG No data
1160964694_1160964705 21 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964694_1160964704 5 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964704 19:1741978-1742000 GGAGAGCTGGGATGAGAACCTGG No data
1160964694_1160964703 -7 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964703 19:1741966-1741988 AGCTGGGAGATGGGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160964694 Original CRISPR CCCAGCTGGTGTCCTTGGGG TGG (reversed) Intergenic