ID: 1160964696

View in Genome Browser
Species Human (GRCh38)
Location 19:1741953-1741975
Sequence TCTCCCAGCTGGTGTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160964696_1160964704 2 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964704 19:1741978-1742000 GGAGAGCTGGGATGAGAACCTGG No data
1160964696_1160964706 19 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964706 19:1741995-1742017 ACCTGGACTCAATCCCCAGCGGG No data
1160964696_1160964705 18 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964696_1160964703 -10 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964703 19:1741966-1741988 AGCTGGGAGATGGGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160964696 Original CRISPR TCTCCCAGCTGGTGTCCTTG GGG (reversed) Intergenic