ID: 1160964701

View in Genome Browser
Species Human (GRCh38)
Location 19:1741964-1741986
Sequence CAGCTCTCCCATCTCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160964701_1160964705 7 Left 1160964701 19:1741964-1741986 CCAGCTGGGAGATGGGAGAGCTG No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964701_1160964704 -9 Left 1160964701 19:1741964-1741986 CCAGCTGGGAGATGGGAGAGCTG No data
Right 1160964704 19:1741978-1742000 GGAGAGCTGGGATGAGAACCTGG No data
1160964701_1160964706 8 Left 1160964701 19:1741964-1741986 CCAGCTGGGAGATGGGAGAGCTG No data
Right 1160964706 19:1741995-1742017 ACCTGGACTCAATCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160964701 Original CRISPR CAGCTCTCCCATCTCCCAGC TGG (reversed) Intergenic