ID: 1160964703

View in Genome Browser
Species Human (GRCh38)
Location 19:1741966-1741988
Sequence AGCTGGGAGATGGGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160964691_1160964703 15 Left 1160964691 19:1741928-1741950 CCACACAGAGAGGTCGTGAGAGC No data
Right 1160964703 19:1741966-1741988 AGCTGGGAGATGGGAGAGCTGGG No data
1160964694_1160964703 -7 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964703 19:1741966-1741988 AGCTGGGAGATGGGAGAGCTGGG No data
1160964696_1160964703 -10 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964703 19:1741966-1741988 AGCTGGGAGATGGGAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160964703 Original CRISPR AGCTGGGAGATGGGAGAGCT GGG Intergenic
No off target data available for this crispr