ID: 1160964705

View in Genome Browser
Species Human (GRCh38)
Location 19:1741994-1742016
Sequence AACCTGGACTCAATCCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160964697_1160964705 17 Left 1160964697 19:1741954-1741976 CCCAAGGACACCAGCTGGGAGAT No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964701_1160964705 7 Left 1160964701 19:1741964-1741986 CCAGCTGGGAGATGGGAGAGCTG No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964698_1160964705 16 Left 1160964698 19:1741955-1741977 CCAAGGACACCAGCTGGGAGATG No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964694_1160964705 21 Left 1160964694 19:1741950-1741972 CCACCCCAAGGACACCAGCTGGG No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data
1160964696_1160964705 18 Left 1160964696 19:1741953-1741975 CCCCAAGGACACCAGCTGGGAGA No data
Right 1160964705 19:1741994-1742016 AACCTGGACTCAATCCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160964705 Original CRISPR AACCTGGACTCAATCCCCAG CGG Intergenic
No off target data available for this crispr