ID: 1160965030

View in Genome Browser
Species Human (GRCh38)
Location 19:1743597-1743619
Sequence CAGCTCCCTGAACCTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160965030_1160965038 29 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965038 19:1743649-1743671 GAACGAGTGTCCGGAAGGGATGG No data
1160965030_1160965037 25 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965037 19:1743645-1743667 ATGGGAACGAGTGTCCGGAAGGG No data
1160965030_1160965033 6 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965033 19:1743626-1743648 CAGTTTGCTCACTCACAAAATGG No data
1160965030_1160965036 24 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965036 19:1743644-1743666 AATGGGAACGAGTGTCCGGAAGG No data
1160965030_1160965035 20 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965035 19:1743640-1743662 ACAAAATGGGAACGAGTGTCCGG No data
1160965030_1160965034 7 Left 1160965030 19:1743597-1743619 CCTTTTTAAGGTTCAGGGAGCTG No data
Right 1160965034 19:1743627-1743649 AGTTTGCTCACTCACAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160965030 Original CRISPR CAGCTCCCTGAACCTTAAAA AGG (reversed) Intergenic
No off target data available for this crispr