ID: 1160967627

View in Genome Browser
Species Human (GRCh38)
Location 19:1753570-1753592
Sequence CGCAGCCACCGGGGAGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160967616_1160967627 12 Left 1160967616 19:1753535-1753557 CCGGGCCGTGCGCCGCGCAGCCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290
1160967615_1160967627 17 Left 1160967615 19:1753530-1753552 CCGGGCCGGGCCGTGCGCCGCGC 0: 1
1: 0
2: 8
3: 42
4: 329
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290
1160967619_1160967627 0 Left 1160967619 19:1753547-1753569 CCGCGCAGCCTGGCAGCCTCGCG 0: 1
1: 0
2: 3
3: 29
4: 257
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290
1160967614_1160967627 29 Left 1160967614 19:1753518-1753540 CCGCGCTCGCAGCCGGGCCGGGC 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290
1160967618_1160967627 7 Left 1160967618 19:1753540-1753562 CCGTGCGCCGCGCAGCCTGGCAG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290
1160967620_1160967627 -8 Left 1160967620 19:1753555-1753577 CCTGGCAGCCTCGCGCGCAGCCA 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160967627 Original CRISPR CGCAGCCACCGGGGAGCGGG CGG Exonic
900154602 1:1198881-1198903 CGCAGCCACGGGGGACTGAGGGG + Intergenic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900241511 1:1619663-1619685 CCCAGCCCCCGGGGAGAGGTGGG + Intronic
900243716 1:1628422-1628444 CCCAAGGACCGGGGAGCGGGAGG + Intronic
900480870 1:2898561-2898583 AGGAGCCACCGGGGACTGGGAGG - Intergenic
900524226 1:3120620-3120642 GGCAGCCCCCTGGGAGCGGGAGG + Intronic
900577168 1:3389143-3389165 TGCAGCCACTGGGGAGAGGCAGG + Intronic
900673394 1:3869612-3869634 CGCACCCACCGTGGAGGGGTAGG - Exonic
901662999 1:10810438-10810460 CCCAGCCTCCGGGCAGCTGGTGG - Intergenic
902336814 1:15758821-15758843 CGGAGCCGCCGGGGCGCGGGCGG + Intronic
902839003 1:19063645-19063667 AGCAGCAGCCGGGGAGCTGGCGG - Intergenic
903075800 1:20765051-20765073 CGCAGCTACCCGGGAGGCGGAGG + Intronic
903226043 1:21894683-21894705 GGCAGCCCCCGGGGAGGGGCTGG + Intronic
903795096 1:25922822-25922844 CGCGGGGACCTGGGAGCGGGTGG + Intergenic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
905079352 1:35303519-35303541 CGCAGCCACTTGGGAGGGTGAGG - Intronic
905656976 1:39691608-39691630 CGGAGTCGCCGGGAAGCGGGAGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
908581912 1:65525537-65525559 CGCAGCCGCCCCTGAGCGGGAGG - Intronic
909585187 1:77281742-77281764 TGCAGCTACCGGGGACCAGGTGG - Intergenic
914748444 1:150515870-150515892 CCCAGCCCACGGGGAGCGGGCGG + Intergenic
915463336 1:156082214-156082236 CCCAGCCCCCGGGGTGGGGGTGG + Intergenic
917305495 1:173619710-173619732 CCCAGCCACTCGGGAGGGGGAGG + Intronic
918044827 1:180935489-180935511 CGCCGGCACCGGGCAGCGAGAGG + Exonic
920912628 1:210232881-210232903 CGCAGTCACCGCCGAGCGGGCGG + Exonic
921930174 1:220748471-220748493 GGCAGCGACCGGAGACCGGGAGG - Exonic
922364503 1:224851378-224851400 CTCAGCCACCCTGGAGCAGGTGG - Intergenic
922422365 1:225468433-225468455 CACAGGCACTGGGGAGTGGGTGG + Intergenic
922440812 1:225653504-225653526 CCAAGCCTCTGGGGAGCGGGAGG - Intergenic
924511147 1:244730166-244730188 CGCAGCAACTGCGCAGCGGGGGG + Intergenic
1064032628 10:11892874-11892896 CCCAGCCACTGGGGAGGCGGAGG - Intergenic
1066312526 10:34211662-34211684 CCCAGCTACTGGGGAGCGTGAGG + Intronic
1067094601 10:43291704-43291726 CGCTTGCACCCGGGAGCGGGAGG - Intergenic
1069726768 10:70585301-70585323 CTCAGCCTCCGGAGAGAGGGCGG + Intergenic
1070610156 10:77927066-77927088 TGTGGCCACGGGGGAGCGGGTGG - Intergenic
1071784093 10:88880168-88880190 CGCCGCCACAGAGGAGGGGGCGG + Exonic
1071794587 10:88991013-88991035 CGCGGGCACCTGGGAGCGGCGGG + Exonic
1073063193 10:100744295-100744317 CGCAGACCCAGGGAAGCGGGGGG + Intronic
1076843242 10:133056875-133056897 CCCAGCCACAGGGGACCCGGGGG + Intergenic
1076898883 10:133327316-133327338 CGCAGCCTCAGGGGAGTCGGAGG + Intronic
1076944970 10:133640544-133640566 CCCAGCCCCGGGGGCGCGGGAGG - Intergenic
1076993794 11:288984-289006 CGCTGCCAGCGGGGACCGAGGGG + Intergenic
1077076894 11:706103-706125 CGGAGTCACCCGAGAGCGGGCGG - Exonic
1077334286 11:1996608-1996630 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1077891120 11:6418944-6418966 CGCAGCCACCGGGGCTGGGCCGG + Intronic
1078891391 11:15561253-15561275 ACCAGGCACCGGGGAGCAGGGGG - Intergenic
1079803234 11:24896628-24896650 ACCAGGCACCGGGGAGCAGGGGG - Intronic
1083709449 11:64539130-64539152 CGGAGCCAGAGGGGGGCGGGGGG + Intergenic
1084916723 11:72434252-72434274 GGCAGCCACCGGGGGGCGCCAGG - Exonic
1088763429 11:112953469-112953491 CATTGCCACCGGGGAGTGGGAGG + Intergenic
1090391050 11:126387559-126387581 CGCAGCCACTGGGGAGGCTGAGG + Intronic
1202817269 11_KI270721v1_random:51790-51812 CGCAGCGGGCGGCGAGCGGGAGG - Intergenic
1095755612 12:45763352-45763374 CCCAGCTACCGGGGAGGTGGAGG + Intronic
1095947121 12:47759565-47759587 CCCGGCCACCAGGGAGCGCGCGG - Intronic
1095998010 12:48105839-48105861 CGCGGCCACCGGACAGCAGGGGG + Intronic
1096571002 12:52523106-52523128 CACAGACACCAGGGAGAGGGTGG + Intergenic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1099989711 12:89709096-89709118 CGCGGGCACCGGAGAGCGGACGG + Intronic
1099989753 12:89709259-89709281 CGCCGCCAGCGTGGAGCGGGAGG - Intronic
1104950747 12:132438851-132438873 CGAAGCCACCGGGGAGCTCTGGG - Intergenic
1105479939 13:20765526-20765548 CGCAGCCACTGGGGAGGCTGAGG - Intronic
1105512147 13:21060667-21060689 CGCAGCCACCGGGGGCTGAGGGG + Intronic
1106322957 13:28659263-28659285 CGCCGCCACCGGGGACGGGTTGG - Intronic
1107505304 13:41027564-41027586 AGCAGCCACCAGGTAGCTGGCGG - Intronic
1107882287 13:44843255-44843277 AGGAGCCAGCGGGGAGTGGGAGG + Intergenic
1108618024 13:52154840-52154862 CCCAGCCACTGGGGAGGGTGAGG + Intronic
1111473425 13:88717055-88717077 CCCAGCCACCGGGGAGGATGAGG - Intergenic
1112450186 13:99501172-99501194 AGCAGCAAACGGGGAGCGGCTGG + Intergenic
1113430538 13:110246635-110246657 TGCAGCCAGCAGGGAGCCGGTGG - Intronic
1113936180 13:113996262-113996284 CCCTGCCCCGGGGGAGCGGGAGG - Intronic
1114554047 14:23551375-23551397 CGCGGCCACCGAGCAGCGCGAGG + Exonic
1119652784 14:76395360-76395382 TGCAGCCCCCGGGGAGCCAGTGG - Intronic
1119759517 14:77141064-77141086 CGCAGCCTCCGCGGAGAGCGTGG + Intronic
1120914796 14:89701676-89701698 CGCCGGCGCCGGGAAGCGGGGGG - Intergenic
1121454220 14:94027962-94027984 CTTAGCCACCCGGGAGCTGGAGG + Intronic
1123204035 14:106694773-106694795 TGGAGCCACCGGGGGGGGGGGGG - Intergenic
1125677863 15:41512087-41512109 CGCAGCCAGTGGGGATGGGGCGG - Intronic
1129293091 15:74583599-74583621 CCCAGCCACTTGGGAGCCGGAGG + Intronic
1130656509 15:85795052-85795074 CGCCGGCACCGGGGGGTGGGGGG + Intergenic
1131049131 15:89334753-89334775 CGCAGCCTCGGGGTAGCGTGTGG + Exonic
1131262227 15:90893404-90893426 TGCATCCACCGGTGAGTGGGCGG + Exonic
1132657270 16:1046581-1046603 CCCAGCCACGGCGGAGCAGGCGG + Intergenic
1132703728 16:1232300-1232322 AGCAGCCCCAGGGGAGCGGCCGG - Intergenic
1132704782 16:1239061-1239083 AGCAGCCCCAGGGGAGCGGCCGG + Intergenic
1132707790 16:1254095-1254117 AGCAGCCCCAGGGGAGCGGCCGG + Intergenic
1132742247 16:1420639-1420661 GGCAGACACCGGCGGGCGGGCGG - Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1134484822 16:14649531-14649553 CTCAGGCACCTGGGAGCAGGTGG - Intronic
1134615747 16:15650191-15650213 CGCAGGCTCCGGGGCGGGGGCGG + Intronic
1138187595 16:54988313-54988335 TGAAGCCACTGGGGAGCTGGAGG + Intergenic
1138328011 16:56191502-56191524 CGCAGCCAGCCGGGAGCTCGAGG - Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1140097203 16:71884610-71884632 CGAAGCCACCGCGAAGCGTGGGG - Intronic
1141682692 16:85553632-85553654 CGCAGCCACCGAGCTGCTGGCGG + Intergenic
1142064053 16:88050270-88050292 CCCAGCCACCGGGGAGGCTGAGG - Intronic
1142468509 17:148955-148977 CACAGACACAGGGGAGCTGGGGG - Intronic
1142610825 17:1108634-1108656 CGCCGCCTCCCTGGAGCGGGTGG - Intronic
1142611549 17:1111317-1111339 TCCAGCCACCGGGGACAGGGTGG - Intronic
1142983628 17:3685464-3685486 TGCGGCCGCCGGGGAGAGGGTGG + Intronic
1143124292 17:4631771-4631793 CACAGCCACCTGGGAGGGAGAGG + Exonic
1143510533 17:7393170-7393192 TGCAGCCACAGTGCAGCGGGCGG + Exonic
1144749689 17:17639812-17639834 CCCAGCCACTGGGGAGGGTGAGG + Intergenic
1145260258 17:21350558-21350580 GGCAGCCATCGGGGAGGTGGAGG - Intergenic
1145714785 17:27009302-27009324 GGCAGCCATCGGGGAGGTGGAGG + Intergenic
1145922644 17:28622082-28622104 CGCAGCCTGAGGGGGGCGGGGGG + Intronic
1146442906 17:32912736-32912758 GGCAGCCACTGGGAAGCAGGAGG - Intergenic
1146651364 17:34608750-34608772 CGCAGAGACAGGGGAGCAGGTGG + Intronic
1147156027 17:38544866-38544888 GGCAGCCACCTGGGGGCGGAGGG + Intronic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1148388641 17:47254240-47254262 CGCAGCCCCGGGTGAGCGCGGGG - Intronic
1148755621 17:49971665-49971687 CGCAGCCAGAGAGGCGCGGGTGG + Intronic
1150492434 17:65583833-65583855 GGAAGCCAGAGGGGAGCGGGAGG - Intronic
1151317800 17:73334794-73334816 CAGAGGCACTGGGGAGCGGGTGG + Exonic
1151615226 17:75205683-75205705 CGCAGCCAGCTCTGAGCGGGAGG + Exonic
1152744184 17:82031594-82031616 CGCGGCCGGCGGGGGGCGGGGGG - Intergenic
1152797988 17:82317307-82317329 CACAGCCCCCAGGAAGCGGGTGG - Intronic
1153036266 18:765480-765502 CGCTTGAACCGGGGAGCGGGAGG - Intronic
1154202323 18:12308166-12308188 CGCAGCCATTGGCGAGCGGCGGG + Exonic
1155229475 18:23758552-23758574 CTCAGCCCCCAGGGAGAGGGGGG - Intronic
1155330259 18:24708426-24708448 CGCAGCTACCGGGGAGGCTGAGG + Intergenic
1155979045 18:32161879-32161901 CTCAGCCACCGGGGAGGCTGAGG + Intronic
1157260933 18:46174690-46174712 CGCAGTCCCCGGGCTGCGGGGGG + Intronic
1157279151 18:46334380-46334402 CGCAGGCACCGGGGCGGGGGCGG + Intronic
1157324101 18:46656872-46656894 CCCAGCCTGCGGGGGGCGGGTGG - Intronic
1157691981 18:49691355-49691377 GGCAATCACTGGGGAGCGGGTGG - Intergenic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160879741 19:1313991-1314013 CACGGCCACCGGGGAGCGCAGGG - Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1161088320 19:2345128-2345150 AGCAGCCACCAGGCAGCGAGAGG + Intronic
1161212349 19:3074012-3074034 GGCAGCCAAGGGGGGGCGGGTGG - Intergenic
1161238169 19:3208137-3208159 CGCCACCATCGGGGAGCGGGAGG - Exonic
1161396038 19:4045427-4045449 CCCAGCCCCAGGGGAGAGGGGGG + Exonic
1161442123 19:4297959-4297981 GGGAGCCAGCGGGGAGAGGGAGG - Intronic
1161682833 19:5688561-5688583 AGCAGCCAGCGGGCAGCGGGAGG + Intronic
1161768062 19:6217582-6217604 CGCTGGCCCTGGGGAGCGGGTGG + Intronic
1162007179 19:7788319-7788341 CGCAGCCTCCACGGAGCGCGCGG + Intergenic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1162445072 19:10718030-10718052 CGCAGCCCCCGGGGCCGGGGCGG + Intergenic
1162913482 19:13862316-13862338 CTCAGCTACCGTGGAGTGGGAGG + Intronic
1163115006 19:15183934-15183956 CGCAGCCACTGGGGAGGCTGAGG + Intronic
1163262711 19:16200783-16200805 CGCAGCCTCCTGGAAGCGGAAGG - Intronic
1163334332 19:16661138-16661160 CGCAGTCGCCGGGCCGCGGGCGG + Exonic
1163694471 19:18757016-18757038 CGCAGCCACTGGGGTGCCCGAGG - Intronic
1164382552 19:27747182-27747204 AGCAGCCACCCGGTGGCGGGAGG + Intergenic
1164498730 19:28793762-28793784 CGCAGCCGTGGGGCAGCGGGTGG + Intergenic
1165243111 19:34482477-34482499 CGCAGGCTCCGGGGAGCGAGCGG - Exonic
1165495403 19:36149798-36149820 TGCAGCCACTGGGGAGAGGAGGG - Exonic
1165958386 19:39515790-39515812 CGCGGCCAGCGGGGTGCGCGTGG - Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166361151 19:42253587-42253609 CCCAGCCACCCGGGAGCGAGTGG + Intronic
1166361715 19:42255274-42255296 CGCAGCCACTGAGGACCGGCCGG + Intergenic
1167065353 19:47181592-47181614 CCCAGCTACCTGGGAGGGGGAGG - Intronic
1167960927 19:53103562-53103584 AGGAGCCACCGGGGAGGGGTGGG + Intergenic
1168594503 19:57664447-57664469 CGCAGCACCCGGGGCGGGGGAGG + Intergenic
925118714 2:1401383-1401405 CCCAGCCACAGGGGAGTTGGTGG + Intronic
925922102 2:8645093-8645115 CGCGGCCACCAGGGAGCGTGGGG - Intergenic
926901145 2:17753525-17753547 CCCAGCCACCCGGGAGAGGCAGG - Intronic
927576639 2:24206814-24206836 CGCAGCCTCAGGACAGCGGGGGG + Intronic
929818966 2:45258354-45258376 GGCAACCACTGGGGAGTGGGTGG - Intergenic
930700739 2:54456458-54456480 CCCGGCCGCCGAGGAGCGGGAGG + Exonic
931232035 2:60383123-60383145 CGCTGGGACCGGGAAGCGGGCGG + Intergenic
931309597 2:61065877-61065899 CGCAGCCGCCTGCAAGCGGGCGG + Intronic
931695034 2:64865150-64865172 GGCAGCCACCGGGCACAGGGCGG - Intergenic
935622817 2:105144075-105144097 CGCAGCTGCCGGGGGCCGGGAGG - Intergenic
936163498 2:110101960-110101982 CCCAGCCACCGGGCCGCGGTGGG - Intronic
937764897 2:125649575-125649597 GGCAGCCACCTGGAAGCAGGAGG - Intergenic
938071862 2:128312600-128312622 CTCAGCCACCTGTGAGCAGGTGG + Intronic
938301125 2:130213705-130213727 CGCAGCGACCGGGGCCGGGGCGG - Intergenic
938406288 2:131035006-131035028 CGCAGCGCCCGGGGAGAGGCGGG - Intronic
940639917 2:156334314-156334336 CCCAGCCGCCGGCGAGCTGGGGG - Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
944415030 2:199471541-199471563 CGAAGCCTCCAAGGAGCGGGCGG + Intergenic
944743613 2:202635162-202635184 CCCAGTCACCGGGGAGGGGGGGG + Intergenic
946114926 2:217452977-217452999 CCCAGCAACCGGGGGGTGGGTGG + Intronic
946326201 2:218985749-218985771 CGCAGCGACAGGCGAGAGGGAGG - Intergenic
947632290 2:231662110-231662132 CGCAGGCGCCGGTGCGCGGGTGG - Intergenic
947724005 2:232386458-232386480 GGCAGGCAGTGGGGAGCGGGTGG - Intergenic
948402363 2:237692920-237692942 TGGAACCACCGGGGAGCGGCTGG + Intronic
1169119120 20:3084790-3084812 GGGAGCCACTGGGGAGGGGGTGG - Intergenic
1170617981 20:17969244-17969266 CGCACCCACGGCGGAGCGGGAGG + Intronic
1172275020 20:33674548-33674570 CGCGGCCACGGCGGAGGGGGAGG + Intergenic
1172362750 20:34325647-34325669 CTCAGCAAACGGAGAGCGGGAGG - Intergenic
1173856097 20:46251537-46251559 CGCGGCGACGGGGGCGCGGGCGG - Exonic
1174362985 20:50040137-50040159 CTCAGCCTCCGGGGACAGGGAGG - Intergenic
1174485901 20:50861135-50861157 TGAAGTCACCTGGGAGCGGGAGG + Intronic
1174611625 20:51802190-51802212 CGCAGGCTTCGGGGAGCGGGCGG - Intronic
1175916167 20:62427057-62427079 CGCAGCCACAGGGGTGAGGGTGG - Intronic
1176171147 20:63696887-63696909 CGCAGAGACAGGGGAGCGGCTGG + Exonic
1176407690 21:6430388-6430410 CAGAGCCACCGGGGAGAGGCAGG - Intergenic
1176619143 21:9043121-9043143 CGCAGGCGCCGGGGGGTGGGGGG - Intergenic
1178077190 21:29023148-29023170 CCCAGCCACTGGGGAGGGTGAGG + Intergenic
1178282810 21:31298037-31298059 CACAGCCACCTGGGTGGGGGAGG + Intronic
1179132105 21:38646962-38646984 GGCAGCCACCGGTGAGCTGATGG - Intronic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179683180 21:43038719-43038741 CAGAGCCACCGGGGAGAGGCAGG - Intergenic
1179797400 21:43793409-43793431 GGCAGCCACCAGGGTGCCGGCGG + Intronic
1179902521 21:44401466-44401488 CACAGCCACCGGGGTGGGGCTGG - Intronic
1180150714 21:45945840-45945862 GGCTGCCATCGGGGAGCCGGTGG - Intergenic
1180622560 22:17171740-17171762 CGCAGCCACCCGGGGCCCGGGGG + Intergenic
1181911807 22:26244377-26244399 CCTAGCCACTGGGGAGAGGGAGG + Intronic
1181964255 22:26645535-26645557 CCCCACCACCGGGGAGAGGGCGG - Intergenic
1182549576 22:31093579-31093601 TGTAGCCACCGTGGAGCCGGTGG + Intronic
1182573778 22:31259107-31259129 CCCAGCCACCTGTGAGCAGGTGG - Exonic
1183034518 22:35131056-35131078 GGCAGCCACAAGGGAGCGTGGGG + Intergenic
1183102170 22:35590871-35590893 GGCAGCCACTGGGGAAGGGGTGG + Intergenic
1183683653 22:39349852-39349874 CGCAGCTCGCGGGGCGCGGGCGG - Intergenic
1183720194 22:39557908-39557930 CTGAGCCCCCGGGGCGCGGGGGG - Intergenic
1185089014 22:48755616-48755638 CGCAGCCTCCCAGGAGCGGGGGG - Intronic
1185113774 22:48919723-48919745 CGCAGCCACCTGGGAGGCTGAGG - Intergenic
1185346247 22:50312071-50312093 CGCCACCACTGGGGAGTGGGAGG + Exonic
1185420194 22:50730764-50730786 CGCAGCCCCGGGGGCCCGGGCGG + Intergenic
949499765 3:4668581-4668603 CGCAGCTACTGGGGAGCCTGAGG - Intronic
950360170 3:12444448-12444470 AACAGCCACAGGGGAGGGGGAGG - Intergenic
950730401 3:14951861-14951883 CCCAGCCACTGGGGAGGCGGAGG - Intronic
952453742 3:33453787-33453809 ACCAGGCACCGGGGAGCAGGGGG - Intergenic
954254067 3:49391625-49391647 CCCAGCTACCGGGGAGGCGGAGG - Intronic
954632768 3:52056231-52056253 CGCAGGCACCGGGGCGGGCGCGG - Exonic
955189153 3:56744206-56744228 GGCAGGCCACGGGGAGCGGGTGG - Intronic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
959978170 3:112485158-112485180 CCCAGCCACCGGGGAGGCTGAGG - Intronic
962676948 3:137764570-137764592 GGCAGCCCCGGGGGAGCGAGTGG - Exonic
963365111 3:144324133-144324155 TGGACCCACCGGGGAGCTGGGGG + Intergenic
966183580 3:177208606-177208628 CCCAGCTACCGGGGAGCCTGAGG + Intergenic
967063098 3:185889882-185889904 CGCAGCCACCTGGGAGGCTGAGG + Intergenic
967717630 3:192781282-192781304 CGCAGCTACTGGGGAGCCTGAGG - Intergenic
968085997 3:195874119-195874141 GGCAGCCACCGGGGAGCCCGTGG - Intronic
968135413 3:196216667-196216689 CGCAGGCACCGGGGTGAGGAAGG - Exonic
968434926 4:579491-579513 CCCTGCCACTGGGGAGCTGGTGG + Intergenic
969061415 4:4438170-4438192 CCCAGTCACCTGGGAGCTGGCGG - Intronic
970604398 4:17665892-17665914 AGCAGCAACTGGGGGGCGGGGGG - Intronic
971183486 4:24352119-24352141 CAGAGCCACCCGGGAGTGGGAGG + Intergenic
975401504 4:73944284-73944306 CGCAGTAGCCGGGGAGCGCGGGG + Intergenic
975584927 4:75940321-75940343 TGCAGCCTCCCGGGAGTGGGGGG + Intronic
976389968 4:84497526-84497548 GGCAGGCATCGGGGCGCGGGTGG + Intronic
981093328 4:140755808-140755830 CCCAGCCCCAGGGGACCGGGCGG + Intronic
985448352 4:190041053-190041075 CCCAGCCCCGGGGGCGCGGGAGG - Intergenic
987080294 5:14419771-14419793 CACAGCCACCAGAGAGCTGGGGG - Exonic
988134288 5:27149901-27149923 CTCAGCCACCGGGGAGTCTGAGG - Intergenic
990557838 5:56952488-56952510 CACAGACACCGCGGCGCGGGAGG + Intronic
991405145 5:66294052-66294074 GGGAGCCACCGGGGAGCTTGTGG - Intergenic
992052849 5:72956508-72956530 CCCAGCCAGCGCGCAGCGGGAGG - Intronic
992067210 5:73119802-73119824 CGCAGACACGTGGGTGCGGGAGG + Intergenic
992105506 5:73447166-73447188 CGCCGCCACCGGCGAGGGCGAGG + Exonic
998208367 5:140175426-140175448 CGCAGCCCCTGGGGAGGGGCAGG + Intronic
998407683 5:141883219-141883241 GGCAGCCCCCGGGGACCCGGTGG + Intergenic
998957698 5:147454031-147454053 CACAGCCACCAGGGGGCGCGAGG + Intronic
1001982557 5:176046892-176046914 CACAGCCACCTGGGACCTGGTGG - Intergenic
1002234904 5:177797165-177797187 CACAGCCACCTGGGACCTGGTGG + Intergenic
1002580971 5:180209234-180209256 CTCAGGCAGCGCGGAGCGGGCGG + Intergenic
1002801713 6:529262-529284 CGAAGACACCTTGGAGCGGGTGG + Intronic
1005764044 6:28993182-28993204 CCCAGCTACTGGGGAGTGGGAGG - Intergenic
1006396251 6:33789177-33789199 CGCAGGCGCGGCGGAGCGGGCGG + Intergenic
1007327564 6:41073563-41073585 CGCTGGGAGCGGGGAGCGGGGGG - Intronic
1007623496 6:43229162-43229184 CGCAGCTGCCGGGGGTCGGGGGG + Intronic
1012474186 6:99603305-99603327 CGCGGCCCCCGAGGCGCGGGTGG - Intergenic
1016820562 6:148342804-148342826 CGCAGCAACAGGGTAGCAGGAGG - Exonic
1017573977 6:155780822-155780844 CCCAGCCACTGGGGAGGTGGAGG - Intergenic
1018400010 6:163413516-163413538 CGCACCCACGGGGCGGCGGGCGG - Intergenic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1019473560 7:1233434-1233456 GGCGGCCAGCGGGTAGCGGGAGG + Intronic
1021447533 7:20749341-20749363 CGCAGCTCCCGGGGAGGGTGAGG - Intronic
1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG + Intergenic
1026239095 7:68556295-68556317 CCCAGCCACTGGGGAGCCTGAGG - Intergenic
1026803968 7:73418118-73418140 CTCAGCCACCCGGGAGGGAGAGG + Intergenic
1028796385 7:94908051-94908073 CGCGTCCACCGTGGGGCGGGGGG + Intronic
1029471639 7:100758439-100758461 GCCTGCCACCGGGCAGCGGGTGG + Intronic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032633341 7:133678724-133678746 CCCAGCCACCTGGGAGCCTGAGG - Intronic
1032853598 7:135815962-135815984 GGCACCCACCGGGGTGCAGGTGG + Intergenic
1033290538 7:140079185-140079207 CGCAGCCATCTGGGATGGGGAGG + Intergenic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034128922 7:148698598-148698620 CGCCGGCAGCGGCGAGCGGGCGG + Intronic
1034255169 7:149720791-149720813 AGCAGCCGCAGGGGTGCGGGGGG + Intronic
1034429796 7:151035566-151035588 CGCAGCCCCTAGGGAGTGGGAGG - Exonic
1035021476 7:155803430-155803452 CTCGGCCACCGGGGAGCCCGAGG - Exonic
1035325673 7:158064443-158064465 CACAGCCATGGGGGAGCCGGGGG + Intronic
1035335833 7:158126526-158126548 ACCAGCCCCCGGAGAGCGGGCGG + Intronic
1035335859 7:158126613-158126635 ACCAGCCCCCGGAGAGCGGGCGG + Intronic
1035362721 7:158324207-158324229 CGGTGTCACCGGGGAGAGGGTGG - Intronic
1035455424 7:159005933-159005955 CGCAGGCACCGGAGCGCGGGAGG - Intergenic
1035700407 8:1634442-1634464 TGCAGCCACCGGGCAGCTGTGGG + Intronic
1036195371 8:6708896-6708918 CGCCGAGACCCGGGAGCGGGAGG - Intronic
1037787574 8:21911889-21911911 CGCAGTCACAGGTGAGGGGGCGG - Exonic
1038614869 8:29084028-29084050 CCCAGCCACTGGGGAGGGTGAGG - Intronic
1040543812 8:48381582-48381604 CCCAGCTACTGGGGAGGGGGAGG - Intergenic
1041533208 8:58895102-58895124 CGCTTCAACCGGGGAGGGGGAGG + Intronic
1041851681 8:62400285-62400307 CCCAGCTACTGGGGGGCGGGTGG - Intronic
1042021875 8:64377836-64377858 CGCAGCCCGGGGGGAGGGGGTGG - Intergenic
1043455019 8:80404172-80404194 CCCAGCCACCGGGGAGGCCGAGG + Intergenic
1043745590 8:83869765-83869787 CTCAGCCACCGGGGAGAGGATGG + Intergenic
1044973776 8:97644338-97644360 CGCTGCCACCGCGGGGAGGGCGG - Exonic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1046497804 8:115036970-115036992 GGGAGCCACCTGGGAGAGGGGGG - Intergenic
1046932530 8:119855817-119855839 CGCAGCCACCCGGGCGCGGCGGG - Exonic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1050251602 9:3750448-3750470 CCCAGCCACTGGGGAGGGTGAGG - Intergenic
1055245869 9:74241789-74241811 CCCAGCCACTGGGGAGTGTGAGG - Intergenic
1057179524 9:93022260-93022282 CGCAGCCACTGTGCAGCGGGGGG - Intronic
1057921911 9:99104909-99104931 CCCAGCCCCCGGGGAGCGTGGGG + Intronic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1059430131 9:114245021-114245043 CCCAGCCACCCGTGAGCTGGTGG + Intronic
1060479292 9:124008682-124008704 CGCAGCCTTCGGGGAGCGCCGGG + Intronic
1060530970 9:124346822-124346844 CACAGCCACGGGGGAGCGAAAGG - Intronic
1060916845 9:127397129-127397151 CGCAGCCAATGGGCGGCGGGGGG - Exonic
1061486638 9:130923692-130923714 GGCAGGCACCGGGGACCGTGAGG - Intronic
1061959332 9:133980065-133980087 ACCAGCCACCCGGGAGCAGGAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062306136 9:135907875-135907897 CGTAGGCAGCGGGGAGTGGGCGG + Intergenic
1185840017 X:3380523-3380545 CCCAGCTACCTGGGAGTGGGAGG + Intergenic
1187704464 X:21995799-21995821 CCCAGCCACCCGGGAGCCTGAGG - Intergenic
1194268139 X:91779603-91779625 CGCAGTCTCCGTGGAGCGGGCGG + Intronic
1198872876 X:141194176-141194198 AGCAGCCACCGGGGTGGAGGGGG + Intergenic
1199649743 X:149939605-149939627 CGAAGCCATTGGGGAGCGGCTGG + Intergenic
1199736940 X:150693744-150693766 CGCAGCGCGCGGGGAGGGGGCGG - Intronic
1200585340 Y:5000524-5000546 CGCAGTCTCCGTGGAGCGGGCGG + Intronic
1202378669 Y:24258959-24258981 TGCAGCCACAGGAGAGCGGCCGG + Intergenic
1202492113 Y:25411162-25411184 TGCAGCCACAGGAGAGCGGCCGG - Intergenic