ID: 1160967638

View in Genome Browser
Species Human (GRCh38)
Location 19:1753623-1753645
Sequence CCGCGCGCGCTCCTCAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160967638_1160967644 -2 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967644 19:1753644-1753666 GGCGGGAGGGCAGCCGAGCATGG 0: 1
1: 0
2: 6
3: 34
4: 355
1160967638_1160967651 23 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967651 19:1753669-1753691 CTGAGCCTGGAGAGCCTGGGGGG 0: 1
1: 0
2: 6
3: 122
4: 704
1160967638_1160967649 21 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967649 19:1753667-1753689 AGCTGAGCCTGGAGAGCCTGGGG 0: 1
1: 0
2: 10
3: 98
4: 741
1160967638_1160967647 19 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967647 19:1753665-1753687 GGAGCTGAGCCTGGAGAGCCTGG 0: 1
1: 0
2: 8
3: 93
4: 698
1160967638_1160967650 22 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967650 19:1753668-1753690 GCTGAGCCTGGAGAGCCTGGGGG 0: 1
1: 0
2: 12
3: 69
4: 571
1160967638_1160967648 20 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967648 19:1753666-1753688 GAGCTGAGCCTGGAGAGCCTGGG 0: 1
1: 0
2: 2
3: 55
4: 356
1160967638_1160967645 10 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967645 19:1753656-1753678 GCCGAGCATGGAGCTGAGCCTGG 0: 1
1: 1
2: 2
3: 26
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160967638 Original CRISPR CCGCGCGCGCTCCTCAGCGC CGG (reversed) Exonic