ID: 1160967638

View in Genome Browser
Species Human (GRCh38)
Location 19:1753623-1753645
Sequence CCGCGCGCGCTCCTCAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160967638_1160967647 19 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967647 19:1753665-1753687 GGAGCTGAGCCTGGAGAGCCTGG 0: 1
1: 0
2: 8
3: 93
4: 698
1160967638_1160967648 20 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967648 19:1753666-1753688 GAGCTGAGCCTGGAGAGCCTGGG 0: 1
1: 0
2: 2
3: 55
4: 356
1160967638_1160967650 22 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967650 19:1753668-1753690 GCTGAGCCTGGAGAGCCTGGGGG 0: 1
1: 0
2: 12
3: 69
4: 571
1160967638_1160967651 23 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967651 19:1753669-1753691 CTGAGCCTGGAGAGCCTGGGGGG 0: 1
1: 0
2: 6
3: 122
4: 704
1160967638_1160967644 -2 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967644 19:1753644-1753666 GGCGGGAGGGCAGCCGAGCATGG 0: 1
1: 0
2: 6
3: 34
4: 355
1160967638_1160967649 21 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967649 19:1753667-1753689 AGCTGAGCCTGGAGAGCCTGGGG 0: 1
1: 0
2: 10
3: 98
4: 741
1160967638_1160967645 10 Left 1160967638 19:1753623-1753645 CCGGCGCTGAGGAGCGCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1160967645 19:1753656-1753678 GCCGAGCATGGAGCTGAGCCTGG 0: 1
1: 1
2: 2
3: 26
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160967638 Original CRISPR CCGCGCGCGCTCCTCAGCGC CGG (reversed) Exonic
900191771 1:1355147-1355169 CCGCGCCCCCTCCGCAGCCCCGG - Exonic
900513343 1:3070342-3070364 CCGCGCGCACCCCGCAGCCCCGG + Intronic
900584412 1:3425549-3425571 GCACACGCGCTCCTCAGTGCAGG - Intronic
901086368 1:6614268-6614290 CCGCGCTCGGTCCTCTCCGCCGG + Intronic
901757624 1:11450942-11450964 TCGCGGGGGCTCCTCAGGGCTGG + Intergenic
904162261 1:28530649-28530671 CAGCGCGGGCTCCTCAGCGGTGG + Intronic
905584452 1:39105735-39105757 CGGCCCGCGGGCCTCAGCGCCGG - Intronic
905803854 1:40862154-40862176 CAGCGCGCGGTGGTCAGCGCCGG + Exonic
907489609 1:54800651-54800673 CCGCGCACGCTCCTCTGGGCTGG + Exonic
908523489 1:64966441-64966463 CCGCGACCCCTCCTCAGCCCTGG - Exonic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
912806156 1:112758660-112758682 CCACGCGCCCTGCTCAGCCCCGG + Intergenic
915302976 1:154962003-154962025 TCGCGCGCGCCCCTCCGCGGCGG - Intronic
922440730 1:225653257-225653279 CCGGGCGCACTCCCCCGCGCCGG + Intergenic
1065188611 10:23191983-23192005 CCGCGCGCGCTGAGCAGCGCCGG - Intergenic
1065533699 10:26697986-26698008 CCGCGAGCACCCCTCAGCTCCGG - Intronic
1067091335 10:43267018-43267040 TCGCTCGCGCTCCCCGGCGCCGG - Intergenic
1069651692 10:70053678-70053700 CCTCGCGCCCTCTTCCGCGCCGG - Intronic
1073325833 10:102643699-102643721 CCGCGCGCCCGTCTCCGCGCTGG - Intergenic
1076554301 10:131311835-131311857 CCGCCCGCGCCCCTCCCCGCCGG + Intergenic
1076722629 10:132399333-132399355 CCGCCTGCGCTCAACAGCGCCGG - Intronic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1085476675 11:76793637-76793659 CTGGGCGAGCTCCTCACCGCAGG - Intronic
1086438025 11:86800630-86800652 CCGGGCGGGCTGCTCGGCGCGGG + Exonic
1088332173 11:108665346-108665368 CCGAGCCCCCTCCCCAGCGCCGG - Intronic
1089574426 11:119431484-119431506 CCGACCTCGCTCCTCAGCTCTGG - Intergenic
1091397811 12:164423-164445 CCCCGCCCTCTCCTCAGCCCTGG + Intronic
1091445749 12:543429-543451 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445805 12:543639-543661 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445860 12:543849-543871 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445905 12:544017-544039 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445916 12:544059-544081 CCGCCCCAGCTCCTCAGCTCTGG - Intronic
1094703974 12:32896916-32896938 CCGCGCCCCCTCCTCAGGGAAGG - Intergenic
1097264625 12:57738214-57738236 GCGCGGGCGCGCTTCAGCGCCGG - Exonic
1101692413 12:107093999-107094021 CCGAGCGCGCTCCTGCCCGCCGG - Intergenic
1102278356 12:111599393-111599415 CCCCGCCCGCTCCGCCGCGCCGG + Exonic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113085633 13:106567443-106567465 CCGCGCCCGGTCCCCAGCCCCGG + Intronic
1113656918 13:112073114-112073136 CCGCGCGCGGGCCTCGGCGGGGG - Intergenic
1114309739 14:21455996-21456018 TCGCACCCGCTCCTCAGTGCTGG - Intronic
1114649066 14:24271629-24271651 CCGCGCACGCGCCTCCGAGCCGG - Intronic
1118255076 14:64198714-64198736 CCACTCGTGCTCCTCAGCCCTGG - Intronic
1118693769 14:68364224-68364246 CTGCGCCCACTCCTCATCGCGGG + Intronic
1122038085 14:98962749-98962771 CCGCGCGTGCTCCCCTGGGCTGG - Intergenic
1122082038 14:99273239-99273261 CCCCCCGCGCTCCTCGGCCCAGG + Intergenic
1123047569 14:105526431-105526453 CCCCGCCCCCTCCGCAGCGCCGG - Intergenic
1124268175 15:28256117-28256139 CCGGGCCCGCTCCTCCGCGGTGG + Exonic
1124696898 15:31870824-31870846 CGGCGCGCGCACGTCCGCGCGGG - Intergenic
1132128456 15:99251503-99251525 CCGCTTGCGCTCCGGAGCGCTGG + Exonic
1132699309 16:1215603-1215625 GCCCGCGCCATCCTCAGCGCAGG + Intronic
1132804918 16:1770993-1771015 CCGCGCCCGTTCCTCCGCACAGG - Exonic
1134584034 16:15395859-15395881 CCACGCGGGCTCCTGATCGCGGG + Exonic
1136192259 16:28623499-28623521 CCACGCGGGCTCCTGATCGCGGG - Exonic
1142293259 16:89202097-89202119 CCGCCCGCCCTCCTCGGCGCTGG + Intergenic
1142393432 16:89816967-89816989 CCGCGCGCGCCTCTGAGCTCCGG + Intergenic
1142958325 17:3535731-3535753 ACGCGCGGGAGCCTCAGCGCCGG + Intronic
1143411861 17:6713875-6713897 CCCCGCGCCCTCCGCACCGCGGG + Intergenic
1144828908 17:18121132-18121154 CCCGGCGAGCTCCTCAGCGAGGG - Exonic
1149994810 17:61400844-61400866 CCGCGGGGCCTCCTCTGCGCTGG - Intronic
1152468022 17:80476609-80476631 AGGCGCGGGCTCCGCAGCGCAGG - Intronic
1153935205 18:9914544-9914566 CGGCGCGCGCACCGCAGCGAGGG - Intronic
1156466396 18:37350371-37350393 CCACGCGCGCTCCTCTTCTCAGG + Intronic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1163666624 19:18606661-18606683 CCGCGCGCCCCCGGCAGCGCCGG - Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
1166894683 19:46016141-46016163 CGCCGCGCGCTCCTCATCCCGGG + Exonic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
1168713364 19:58513938-58513960 CCACGCTCCCTCCTGAGCGCAGG - Exonic
927714295 2:25342131-25342153 CCGGGCCGGCTCCGCAGCGCCGG - Intronic
928341494 2:30447131-30447153 CCGCGCTTGCTCCACAGCCCGGG - Intergenic
929936939 2:46299697-46299719 CCTCCTGCGCTCCTTAGCGCCGG + Intronic
932699976 2:73985402-73985424 CCGCGCGCGCGCCGCCGCTCGGG - Intergenic
937369020 2:121285031-121285053 CCGCGCGCGGCCCTTACCGCAGG + Exonic
941095890 2:161239013-161239035 CCCCGCGCGGCCCCCAGCGCCGG + Intergenic
948580628 2:238985535-238985557 CCGCGCGGGCCCCTCAGGGAGGG + Intergenic
1170756914 20:19212853-19212875 ACGCGCGCGGTCCTCGTCGCCGG - Exonic
1172962097 20:38806518-38806540 CCGGGGGCGCTCCTCTGGGCCGG - Intronic
1184796895 22:46738047-46738069 CCGCGCGGGCTCTGCTGCGCTGG - Exonic
1184999678 22:48237753-48237775 CAGCGCCCCCTCCCCAGCGCAGG + Intergenic
962164837 3:133038315-133038337 CCGCGCGCGCCCCTCCGACCAGG - Intergenic
963827433 3:149970647-149970669 CCGCGGGGGCACCGCAGCGCGGG - Intronic
972533125 4:39977819-39977841 CCGGGCGCGCGCCTCTGCGAGGG - Exonic
976812462 4:89111459-89111481 CCGCGTGCGCTCACCCGCGCAGG + Intergenic
982584857 4:157222861-157222883 CCGCGCTCGCTCCCCCGCGCAGG + Intronic
985713907 5:1445410-1445432 CCCCTCCCGCTCCGCAGCGCTGG + Exonic
990347457 5:54884150-54884172 CCGCGCTCACTCCCCAGCGGCGG + Intergenic
991967466 5:72107354-72107376 CCGCGCACTCTCCGCGGCGCTGG + Exonic
992105539 5:73447291-73447313 CGGCCCGGGCGCCTCAGCGCTGG - Exonic
997417516 5:133740457-133740479 CCGCCCCCACTCCTCACCGCAGG + Intergenic
1002788872 6:424265-424287 CCGCGGGCGCTGCTGAGCTCTGG + Intergenic
1003995651 6:11537678-11537700 ACGCGCGCGCCTCTCAGCGCCGG - Intergenic
1004492521 6:16129625-16129647 CTGCGCCCGGCCCTCAGCGCTGG - Intronic
1006860904 6:37170892-37170914 CGGCGCGCCCTCCCCACCGCGGG - Intronic
1008760426 6:54846784-54846806 CCGCGCCCGCCGCACAGCGCCGG - Exonic
1009437727 6:63636476-63636498 GCGCGCCCGCGCCTCAGCGGCGG - Intronic
1018694659 6:166382484-166382506 CAGTGGGCGCTCCTCAGGGCGGG - Intronic
1020212387 7:6166492-6166514 CCGGGTGAGCTCCGCAGCGCTGG - Intronic
1029849339 7:103446084-103446106 CCGCGCGCACTCACCAGCCCGGG + Exonic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1034426849 7:151018478-151018500 CCGCGCGTCCTCCTAATCGCAGG - Intronic
1035221624 7:157409813-157409835 CCGCATGCGCTCCTCAGCGAGGG - Exonic
1037305180 8:17497106-17497128 CGGCGGGCGCTCCTCTTCGCGGG + Intronic
1037855371 8:22367500-22367522 CGGCGCCCGGTCCTCGGCGCAGG - Intronic
1042722517 8:71841694-71841716 CCCTGCGCGCTCCTCCGCGCGGG + Exonic
1049643515 8:143726107-143726129 CCGATCGCGCTCCTCCGCGCTGG + Exonic
1049681901 8:143922717-143922739 CTGGGCGTCCTCCTCAGCGCGGG + Exonic
1055397433 9:75890685-75890707 CCTCGCGCGCTGCTCGGAGCCGG + Exonic
1061134222 9:128724065-128724087 CCCTGGGCGCTCCTCAGCCCTGG - Exonic
1191213188 X:57910006-57910028 CCCCGCGGGCTGCTCTGCGCAGG - Exonic
1195625171 X:106999805-106999827 CCGCGCGCCCCCCGCAGCCCAGG + Intronic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic