ID: 1160968067

View in Genome Browser
Species Human (GRCh38)
Location 19:1755271-1755293
Sequence CTCCCCTCCTCCAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 10, 3: 50, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160968062_1160968067 10 Left 1160968062 19:1755238-1755260 CCGAACGAGCTGCTGTTGTCGGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG 0: 1
1: 1
2: 10
3: 50
4: 321
1160968060_1160968067 11 Left 1160968060 19:1755237-1755259 CCCGAACGAGCTGCTGTTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG 0: 1
1: 1
2: 10
3: 50
4: 321
1160968059_1160968067 12 Left 1160968059 19:1755236-1755258 CCCCGAACGAGCTGCTGTTGTCG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG 0: 1
1: 1
2: 10
3: 50
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160968067 Original CRISPR CTCCCCTCCTCCAGAGTGGG TGG Intronic
900160133 1:1219423-1219445 TTCCGCTCCTCCAGAGGGGCAGG - Intronic
900648282 1:3718725-3718747 CTCCCCTCCCCCTGAGTGTCTGG + Intronic
901045166 1:6391962-6391984 TTCCCCACCTCCAGAGTCGATGG + Intronic
901068172 1:6504460-6504482 TCCCCCTCCTCCACAGTGGGGGG + Intronic
901431037 1:9215181-9215203 CTCTGCTCCTCCAGGGTTGGGGG - Intergenic
902398788 1:16146332-16146354 CTTCCCTCCTCTAGAGGTGGGGG - Intronic
902658743 1:17887066-17887088 GTCACCTCCTCCAGAGGGGCTGG + Intergenic
902721946 1:18309705-18309727 CTGCCCTCTGCCAGTGTGGGAGG + Intronic
902782442 1:18713150-18713172 CTCCACACCTCCAGAGGGTGTGG + Intronic
903647669 1:24904777-24904799 CACCCCTCCTCCGGGGTGGTGGG + Intronic
904148911 1:28420137-28420159 CTCCCAGCCTCCTGAGTGGCTGG - Intronic
904923161 1:34024707-34024729 ATGCCCTCCTCCAGGGAGGGAGG - Intronic
905370374 1:37479794-37479816 CTCGCCTCTTGCAGCGTGGGTGG - Intronic
906087434 1:43148070-43148092 ATCCCCTCCGCAAGAGTGAGAGG + Exonic
906721057 1:48005004-48005026 TTCTCCACCTCTAGAGTGGGAGG + Intergenic
907402040 1:54230180-54230202 CACCCCTCCCCCAGTCTGGGTGG - Intronic
909997253 1:82295658-82295680 CCCACCTCCAACAGAGTGGGTGG + Intergenic
910860883 1:91741537-91741559 CTCCCCTCCTTCAGAGGGGTGGG + Intronic
910982749 1:92975077-92975099 GTCCCCTCCTCCCAAGTGGCTGG + Intergenic
911842629 1:102703699-102703721 CTCATCTCCTCTAGAGTGGAGGG - Intergenic
916081929 1:161239018-161239040 CTCCCTGTCTCCAGAGTAGGGGG - Intergenic
917291737 1:173477731-173477753 CTCCCCGCCTCCGGCGTGGCTGG + Intronic
917613653 1:176715407-176715429 CTCCCCTGCTCCAGTGGGGGTGG - Intronic
918056108 1:181023143-181023165 CTCCCCCCCCCCCCAGTGGGCGG + Intergenic
919465967 1:197921789-197921811 CTCCCTTCCTTCAGAGTGAGAGG - Intronic
920128034 1:203709294-203709316 CTCCCAGCCTCCAGAGAAGGAGG + Exonic
920247614 1:204600190-204600212 CTTCCCTCCTCCAGGCGGGGAGG - Intergenic
922735804 1:227977802-227977824 GGCCCCTCCTCCATGGTGGGAGG + Intergenic
922784689 1:228277075-228277097 CTCCCCTCCTCTCATGTGGGCGG + Intronic
923163409 1:231337380-231337402 CTCCTCCCCTCCAGAGGCGGCGG + Exonic
923217220 1:231859439-231859461 CTCGCCCCTTCCAGAATGGGAGG - Intronic
923780162 1:237015369-237015391 CTTCCCACCTCCTGAGTAGGTGG + Intergenic
1064230977 10:13529041-13529063 CGCCCCTCCTCCCGCGGGGGCGG - Intergenic
1064387400 10:14908946-14908968 TTCCCTTCCTCCACAGTGGCAGG - Exonic
1065722871 10:28643265-28643287 CTCTCCTCCTGCAGAATGGCAGG + Intergenic
1065919009 10:30374626-30374648 CTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1066049334 10:31619915-31619937 CTTCCCTCCTCCAGTGTAGGCGG - Intergenic
1068610923 10:59059139-59059161 CTCTGCTCCTCCAGACTGGTGGG + Intergenic
1069814993 10:71188165-71188187 CTCCCTTCCTATGGAGTGGGGGG + Intergenic
1070665034 10:78336716-78336738 CTGCCCTGCTCCAGCCTGGGAGG - Intergenic
1070681822 10:78454083-78454105 CTTCCCTTCTCCAAAATGGGAGG - Intergenic
1070688466 10:78507416-78507438 CTCCCCTCCTCCAGGGTCTAAGG + Intergenic
1072076186 10:91976406-91976428 CTCCCCACCTCCAGAGCTAGAGG - Intronic
1075626023 10:123965096-123965118 CCCCCCTCCTCCAGGGCTGGTGG - Intergenic
1075723539 10:124600475-124600497 CTCCCCACATCCAGACTGAGAGG - Intronic
1076343363 10:129764908-129764930 CTCCCTTCCTCCTGAGCTGGAGG - Intronic
1077075770 11:701301-701323 CTCCCCTCCTCCCAAGTAGCTGG + Intronic
1078450042 11:11433926-11433948 TTCCACTGCTCCAGAGTGGGAGG + Intronic
1079361223 11:19771959-19771981 CTCCCCTCCACCAGCCTTGGAGG - Intronic
1079861922 11:25683795-25683817 CTGCCCTCACCCAGTGTGGGTGG + Intergenic
1080169142 11:29277688-29277710 TTCCCTGCCTCCACAGTGGGAGG + Intergenic
1082243321 11:49892563-49892585 CTCCGCTCCACCAGAGGGCGGGG - Intergenic
1083624222 11:64063864-64063886 CTCCCCAGCCCCAGAGAGGGTGG + Intronic
1084695360 11:70750380-70750402 ATCCCCTCCTCCAGAGTTTTAGG - Intronic
1084942040 11:72618097-72618119 CTCCCCTCCTCCAGAGTGACAGG + Intronic
1085441565 11:76568607-76568629 CTTCCCTCCTCCAGAAGGTGGGG - Intergenic
1086526645 11:87735374-87735396 CTCTCTTCCTCCAGAGGGTGTGG - Intergenic
1088402960 11:109441354-109441376 CTACCTACCTCCAGAGTGGGAGG - Intergenic
1089395796 11:118135870-118135892 CTCCCCAACCCCAGGGTGGGAGG + Exonic
1095452742 12:42349998-42350020 CTCCCACCCCCCAGAGGGGGTGG + Intronic
1095561977 12:43576020-43576042 CTCACTCCCTACAGAGTGGGAGG - Intergenic
1096185959 12:49580726-49580748 CTCCTCTCTTCCAGAGAGTGAGG + Intronic
1096306986 12:50486282-50486304 CTCCCAGCCTCCAGAGTAGTTGG - Intergenic
1096621548 12:52868814-52868836 CACCCCTCCACCAGAGGGGATGG + Intergenic
1096719943 12:53513735-53513757 CTCCCCTGCTCCACACTGAGAGG - Exonic
1096747613 12:53738819-53738841 CTCCCCACCAGCAGAGTGGTGGG - Intergenic
1097105092 12:56617524-56617546 CTCCCCTCCTGCAGAAATGGAGG - Exonic
1098257381 12:68630793-68630815 CTCCCATCCTCCCGGGTAGGTGG + Intronic
1099208547 12:79756960-79756982 TTCCCCTCCTCCAGAGTTGGAGG + Intergenic
1101345738 12:103884624-103884646 CTCCCCTCCTCCACTGTGTATGG + Intergenic
1102046840 12:109834671-109834693 CTCACTTCCTCCAGGGTGGTTGG + Intergenic
1102112335 12:110373920-110373942 CTCCCCTGCTCCAGCCAGGGAGG - Exonic
1103947239 12:124533196-124533218 CTTCCCTCCTGCCTAGTGGGGGG + Intronic
1104747788 12:131221002-131221024 CTCCCTCCCTCCAGGGTGGCAGG + Intergenic
1105567479 13:21564759-21564781 CTCCCCTCTTCCTCATTGGGAGG - Intronic
1106322269 13:28652439-28652461 CTCCCCATCTCCAGAGTAAGTGG - Intergenic
1107125163 13:36838610-36838632 CTCCCATCCTCCAGAGCTGGAGG + Intergenic
1107505567 13:41029720-41029742 CTGCCCTCATCCAATGTGGGTGG + Intronic
1111055109 13:82938655-82938677 CTCCCTTTCTCCAAAGTGTGTGG + Intergenic
1112632551 13:101178577-101178599 CTCCCCTTCTCCGTAGAGGGTGG + Intronic
1113179917 13:107613039-107613061 CTCCCTTCCTCCAGGGGAGGCGG - Intronic
1113806089 13:113110571-113110593 CTCCCCTCCTCCAGGACGGGCGG + Intronic
1114324398 14:21574360-21574382 CTCTCCTCCTTCTGAGTGGATGG - Intergenic
1114770509 14:25425404-25425426 TGCCTCTCCTCCAGAGTGAGTGG + Intergenic
1115657192 14:35455095-35455117 CACCACTCCTCCAGCCTGGGTGG - Intergenic
1117065192 14:52006532-52006554 CTCACCTCCTCCAGTCTGTGTGG + Exonic
1118983678 14:70735230-70735252 CCCCCCTCCTACAAAGTGGTTGG - Intronic
1119474313 14:74918384-74918406 CCCCACTCCTCCAGAGGAGGTGG - Intronic
1121235814 14:92390612-92390634 GTCCCCTGCCCCAGAATGGGCGG + Intronic
1121527553 14:94629783-94629805 CTCCCCTCCTCCAGACTTCTGGG - Intergenic
1122806553 14:104262895-104262917 CTCCTCTGCCCCAGGGTGGGGGG - Intergenic
1123100143 14:105792085-105792107 CTCTCCTCCTCCAGTGTGTGGGG + Intergenic
1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123629933 15:22254456-22254478 CTCTCCTCCTCTGGAGAGGGAGG - Intergenic
1123667379 15:22618057-22618079 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1123683075 15:22776298-22776320 CGCCTCTCTCCCAGAGTGGGCGG - Intronic
1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123886689 15:24733760-24733782 ATCCCCTCCCCAAGAGTGTGGGG - Intergenic
1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124321221 15:28712624-28712646 CTCTTCTCTTCCAGAGTGGGAGG - Intronic
1124334833 15:28848822-28848844 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
1124481277 15:30082729-30082751 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124487732 15:30134825-30134847 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124522317 15:30414438-30414460 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124522322 15:30414464-30414486 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124536342 15:30551754-30551776 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124542821 15:30603802-30603824 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124542826 15:30603828-30603850 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124562782 15:30791278-30791300 CTCCCCTCTCACAGAGTGGGCGG + Intergenic
1124755792 15:32403470-32403492 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124755797 15:32403496-32403518 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124762304 15:32455812-32455834 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124762309 15:32455838-32455860 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124776322 15:32593232-32593254 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124776327 15:32593258-32593280 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124960528 15:34389966-34389988 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124960537 15:34389992-34390014 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1124977157 15:34536187-34536209 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124977166 15:34536213-34536235 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1125543964 15:40489048-40489070 CTTCCCTCCTCCTGAGTGGCTGG - Intergenic
1126357589 15:47812711-47812733 CTCCCATTCTGCAGAGGGGGAGG - Intergenic
1128072998 15:64808853-64808875 CTCCCCTTCCCCATGGTGGGTGG + Intergenic
1128176668 15:65562239-65562261 GTTCCCTCCTCCAGAGTATGAGG + Intronic
1128745836 15:70113596-70113618 CTCCCCTTCTCCGGAGTGCATGG - Intergenic
1129028957 15:72604923-72604945 CTCCCCTCTCCCAGAGTGGGAGG + Intergenic
1129838142 15:78726885-78726907 CTCCCCTCTCCTGGAGTGGGCGG + Intronic
1130260446 15:82349640-82349662 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130268286 15:82429793-82429815 CTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130268295 15:82429819-82429841 CTCCCCTCTCTCTGAGTGGGCGG + Intergenic
1130280786 15:82519364-82519386 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130472157 15:84235547-84235569 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130479650 15:84350118-84350140 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130492120 15:84438011-84438033 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130503737 15:84517047-84517069 TTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1130550932 15:84889464-84889486 CCCACCTCCTCCTGAGAGGGTGG - Intronic
1130563347 15:84975900-84975922 CTCCCCTCCTCCAGGCCAGGAGG + Intergenic
1130594457 15:85240184-85240206 TTCTCCTCTCCCAGAGTGGGCGG + Intergenic
1131616082 15:94018684-94018706 CTCCCCACCTCCAGAGTGGGGGG - Intergenic
1132184287 15:99790843-99790865 CTCCCCTCTCCCAGAGGGGGCGG + Intergenic
1132434088 15:101782307-101782329 CTCCCCTGTCCCAGAGTGGGTGG - Intergenic
1134276374 16:12780110-12780132 CCCCCTTCCACCAGAGTGTGGGG - Intronic
1135597746 16:23756295-23756317 CCCCCCTCCTCCAAGGTGGGGGG + Intronic
1137738878 16:50745475-50745497 TTCCCATCCTCCAGAGTAGCTGG + Intronic
1138537140 16:57666209-57666231 CCCCCATCTTCCAGAATGGGGGG + Intergenic
1138650399 16:58457315-58457337 CTCCCCTCCTGCAGAGAGCAGGG + Intergenic
1139912763 16:70408348-70408370 CTCCCTGCCTCCTGGGTGGGGGG + Intronic
1141405164 16:83786054-83786076 CATCCCTCCTCCAGAGAGGAGGG + Intronic
1141501730 16:84449368-84449390 GTCCCCTCTTCCCGAGTGAGGGG + Intronic
1141651841 16:85397023-85397045 CTCCCCTCCAGCTGGGTGGGTGG + Intergenic
1141799694 16:86298418-86298440 CTCCCCTCGCCCAGCGTGGAAGG + Intergenic
1141973206 16:87496299-87496321 CTCTCCTCCTCTGGAGAGGGAGG + Intergenic
1142006554 16:87692119-87692141 CTGGCATCCTCCAGGGTGGGTGG - Intronic
1143708463 17:8717017-8717039 CTCCCTTCCTCCTGAGTGTGGGG - Intergenic
1144576389 17:16432334-16432356 CTCCCCACCGCCTGAGTGTGGGG - Intronic
1144648224 17:16989864-16989886 CACCCCTCATCCTGAGTGAGCGG - Intergenic
1145915737 17:28573020-28573042 CTCTCCACCTCCAGAGTCAGAGG + Intronic
1147053753 17:37817988-37818010 ATTCTCTCCTCCAGAGTGGTAGG - Intergenic
1147169475 17:38609550-38609572 CTCCTCTCCTATGGAGTGGGAGG - Intergenic
1147762957 17:42812596-42812618 CTCCTCTCCTCCCGAGTAGCTGG - Intronic
1148907257 17:50919393-50919415 CTCTCCTCCTCCCCAGTGAGAGG + Intergenic
1149483528 17:57023170-57023192 CTCCCCTCCCCTAGAGATGGGGG - Intergenic
1149992799 17:61392158-61392180 CTCCCCTCCTCCAGCAGGGGAGG - Exonic
1150475500 17:65471565-65471587 CTTCCCTCCTTCAGCGTTGGTGG + Intergenic
1150539966 17:66087819-66087841 CTTCCCTCCTCCCAAGTGGAGGG - Intronic
1150859813 17:68790111-68790133 CCCATCTCCTCAAGAGTGGGGGG - Intergenic
1151530088 17:74698543-74698565 CTCCCCTGCTGCTGGGTGGGTGG - Intronic
1152323153 17:79619798-79619820 CTCCCCTCCTCCAGCCCTGGGGG + Intergenic
1152594600 17:81232202-81232224 CACCCCTCCTGCTGTGTGGGAGG + Intronic
1152931284 17:83111460-83111482 AGCCCCTCCTTCAGAGTGAGGGG + Intergenic
1153807010 18:8717648-8717670 CTCCCCTCCCCCAGGGATGGAGG + Intronic
1154217301 18:12424567-12424589 CTCTCCTCCTACAGAGTGCCAGG - Intronic
1154217789 18:12428260-12428282 CTCCCCTCCAGCAGAGTTGATGG + Intronic
1154394627 18:13975756-13975778 ATCCACTTCTCCAAAGTGGGAGG - Intergenic
1157479476 18:48044338-48044360 CTCTCCTCATCCAGCATGGGAGG - Intronic
1160354547 18:78216023-78216045 CTCTCCTCCTCCAGTGTCAGTGG + Intergenic
1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG + Intronic
1160989390 19:1854322-1854344 CTGCCCCCCTCCAGAGAGTGAGG - Exonic
1161955739 19:7493880-7493902 CTCCCCTCTCCCCCAGTGGGGGG + Intronic
1162404386 19:10464829-10464851 ACCCCCGCCTCCAGAGTGGCTGG + Intronic
1163463859 19:17455140-17455162 CTCTCCACCTCCGGAGTGGAGGG + Intronic
1163591238 19:18195164-18195186 CTCCCACCCTCCAGGGTGGCTGG - Intronic
1163677277 19:18661381-18661403 CTCCTCTCCTCCCCAGAGGGAGG + Intronic
1163804704 19:19388392-19388414 CTCTCTTCCTCCACAGTTGGGGG - Intronic
1164498803 19:28794056-28794078 CTCCCCGACTCGCGAGTGGGCGG + Intergenic
1164989622 19:32674829-32674851 CTCCCCTCCTCCAGACCCGAGGG + Intronic
1165774968 19:38399055-38399077 CTCCCCCCTTCCATGGTGGGCGG + Intergenic
1166300039 19:41908072-41908094 TTCCCCAGCCCCAGAGTGGGGGG - Intronic
1166323739 19:42036467-42036489 CTCCCAGCCTCCTGAGTGGCTGG + Intronic
1166675231 19:44736920-44736942 CTCCCAGCCTCCAGAGTGTCTGG + Intergenic
1167296760 19:48654962-48654984 CTCCCCAGCCCCTGAGTGGGAGG + Intergenic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925065154 2:923791-923813 CTCCCCGCCTCCTGAGTAGCTGG + Intergenic
925494039 2:4426232-4426254 AACCCCTTCTCCAGAATGGGGGG - Intergenic
925945339 2:8857266-8857288 CTCCCCTCCTACAGGGCAGGAGG + Exonic
927677216 2:25114854-25114876 ATCCCCTGCCCCAGAGTAGGGGG + Intronic
930476460 2:51888513-51888535 TTCCCCTCCCCCAGGGTGGGGGG + Intergenic
930604539 2:53479889-53479911 CTCCACTCCTTCAGAATGGCAGG - Intergenic
932428509 2:71659051-71659073 CTCACCTCCCCCAGAGTAGCAGG + Intronic
932749423 2:74361975-74361997 CCCCTCTCCTCCAGAATTGGAGG - Intronic
936008502 2:108910160-108910182 TGCCCCTTCTCCAGACTGGGAGG - Intronic
937677204 2:124605101-124605123 CTCCCCTGCTACAGTGTGAGAGG + Intronic
937948006 2:127359021-127359043 CTCCCCTCCTCCTGAATGCCTGG - Intronic
937996356 2:127697675-127697697 CTCCCTTCCTTCAGTGTGGCGGG - Intergenic
938072458 2:128315927-128315949 CAACCCACTTCCAGAGTGGGTGG + Intronic
938765182 2:134456343-134456365 CCCACCTCCTCCAGCTTGGGTGG - Exonic
940118624 2:150238386-150238408 CTGCCCTCCGTCAGAGTGGAAGG + Intergenic
941718304 2:168786840-168786862 CCCCCCTCCTCCAGAGTAGCTGG + Intronic
942045688 2:172098012-172098034 CTCCCCTACTGCAGAGGGGCTGG - Intergenic
942449134 2:176098416-176098438 CTCCCCCCCACCAGAGCAGGAGG + Intergenic
942479312 2:176366233-176366255 GTCTCATCCTCCAGAGTAGGTGG - Intergenic
946249939 2:218405809-218405831 CTCCCCTCCCCCAGAGCGGGTGG + Exonic
946431550 2:219629296-219629318 CCCCCCTCCTCCTGGATGGGAGG - Exonic
946813719 2:223554094-223554116 CTCTCCCACTCCAGAGTTGGTGG - Intergenic
946873980 2:224110207-224110229 CTCTCCTACTCCAGAGGGGATGG + Intergenic
947543651 2:230995607-230995629 CTCCCCTCCCACAGTGCGGGAGG + Intergenic
947662839 2:231882728-231882750 CTCACATCCTCCCCAGTGGGAGG + Intergenic
947665363 2:231901955-231901977 CTCCCCGCCTCCCGAGTAGCTGG - Intergenic
948760997 2:240191032-240191054 CTCCCATCCCCCAAAGTCGGCGG + Intergenic
948867640 2:240783677-240783699 TTGGCCTGCTCCAGAGTGGGTGG - Intronic
948876798 2:240833784-240833806 GTCCACCCCTCCACAGTGGGTGG + Intergenic
1168753728 20:301289-301311 CCTCCCTCCTGGAGAGTGGGGGG - Intergenic
1168895354 20:1320090-1320112 CTCCCTCCCTCCAGGATGGGCGG - Intronic
1168965692 20:1896566-1896588 CCTCCCTCCTCAAGGGTGGGAGG - Intronic
1169125633 20:3125109-3125131 CTCCTCACCTCCAGACGGGGCGG - Intronic
1169897267 20:10517731-10517753 CTCCACACCTCCAGGGAGGGTGG - Intronic
1171446067 20:25205706-25205728 GTCTCCTGCTCCAGTGTGGGTGG + Intronic
1171494635 20:25547251-25547273 CCCCCAGCCTCCAGGGTGGGCGG + Intronic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172833018 20:37852675-37852697 CTCCCCTCCTGCAGTCAGGGTGG + Intronic
1173595191 20:44254453-44254475 CTTCCCTCCTCGGCAGTGGGAGG - Intronic
1173595382 20:44255774-44255796 CTCCCCTGGACCAGAGTGGAAGG + Intronic
1173967800 20:47126544-47126566 CTCCCCGCCAGCTGAGTGGGAGG - Intronic
1174121448 20:48268708-48268730 CTCCTCCCCACCAGAGTGGATGG - Intergenic
1175308567 20:57995069-57995091 CTCCCCTCCACAAAAGTTGGGGG - Intergenic
1176000740 20:62830261-62830283 CAGCCTTCCCCCAGAGTGGGTGG - Intronic
1176190786 20:63808582-63808604 CTGAGCTCCTCCAGCGTGGGTGG + Intronic
1176362154 21:6006650-6006672 CTCCCTTCCCCCAAAGTAGGAGG + Intergenic
1176417169 21:6483274-6483296 CTTCCCTCCTTCAGACTGAGTGG + Intergenic
1176524121 21:7852388-7852410 CTACCCTCCTCCAGGGTGGGGGG - Intergenic
1176546964 21:8206332-8206354 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1176554869 21:8250541-8250563 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1176565915 21:8389379-8389401 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1176573790 21:8433566-8433588 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1178658141 21:34482401-34482423 CTACCCTCCTCCAGGGTGGGGGG - Intergenic
1178875366 21:36410075-36410097 CTCCTATCCTCCAGAGTAGCTGG + Intronic
1179071116 21:38071954-38071976 TTCCTCTCCTACAGAGTGTGCGG + Intronic
1179618493 21:42597022-42597044 ATTCCCTCCTCCAGGGTGTGGGG + Intergenic
1179629209 21:42666330-42666352 CTCCCCGCCTCCCAAGTGTGAGG + Intronic
1179692666 21:43091607-43091629 CTTCCCTCCTTCAGACTGAGTGG + Intergenic
1179761364 21:43531895-43531917 CTCCCTTCCCCCAAAGTAGGAGG - Intronic
1179881667 21:44295697-44295719 CCCCCTTCCTCCAGGGTGGTTGG + Intronic
1180700932 22:17781138-17781160 CTCACCTCCTGCAGTGTGGGGGG - Intergenic
1181091438 22:20475676-20475698 CTCCCAGCCTCCCGAGTGGCTGG + Intronic
1181483919 22:23218755-23218777 CTCCCCTCCACCAGCATCGGAGG - Intronic
1181631706 22:24155111-24155133 CTCCCCTCAGCTGGAGTGGGAGG + Intronic
1182763751 22:32743756-32743778 CTTCCCTCCTGGAGACTGGGCGG + Intronic
1183459315 22:37940483-37940505 CTCCCCACCTCCAGTGTTTGGGG - Intronic
1183513716 22:38251007-38251029 CTCACCTCCTACAAAGTGGGGGG + Intronic
1185392325 22:50569285-50569307 GTCCCTTCCTCCACAGTGTGGGG + Exonic
1185404892 22:50642143-50642165 ATCCCCTCCTCCAGGCCGGGAGG - Intergenic
1203251839 22_KI270733v1_random:122617-122639 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1203259890 22_KI270733v1_random:167700-167722 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
950565726 3:13768523-13768545 CTCCCCAACTCCTCAGTGGGGGG - Intergenic
952568721 3:34687336-34687358 CTTCCCTCCTCCAAAATGTGGGG + Intergenic
953439925 3:42908340-42908362 CTTCCTTGCTCCAGAGTGAGAGG + Intronic
954781261 3:53063087-53063109 CCCGCCTCCACCAGGGTGGGTGG - Intronic
956177853 3:66490276-66490298 CTCCCCTCCTCCAAGATGGAAGG + Intronic
960958249 3:123050473-123050495 CTCCCAAGCTCCAGTGTGGGTGG - Intergenic
961033647 3:123627331-123627353 CTCCCCTCCTCCAGACAGGGTGG - Intronic
961142157 3:124564735-124564757 CCCCACTCCTCCAGAGCCGGTGG + Intronic
961462253 3:127058454-127058476 CTCCCCACCTCCAGAGAGTCTGG + Intergenic
962305201 3:134280032-134280054 CTTCCCTCTTCCAGACTGGCTGG + Intergenic
962323080 3:134407174-134407196 CACCCCTCCTGCCGAGTGGCAGG - Intergenic
963252233 3:143114234-143114256 CTCCCCTCCTCCCAAGGGGCAGG - Intergenic
963430628 3:145197368-145197390 CTCCCCTCTTCCCAAGTGGAAGG - Intergenic
964791912 3:160460571-160460593 CCCCCCTCCTTCTGAGTTGGTGG - Intronic
965576506 3:170222818-170222840 CTCCCCTCCTCCAGGCCGAGTGG - Intronic
967500078 3:190187054-190187076 CTTCCCTCCTCCTGAGTAGCTGG - Intergenic
968613137 4:1566054-1566076 CGCCCCACCTGCAGAGGGGGAGG + Intergenic
968735951 4:2296697-2296719 CTCCCCTCCCCCTCACTGGGAGG - Intronic
968884497 4:3320355-3320377 CTGCTCTGCTCCAGTGTGGGTGG - Intronic
968891511 4:3371871-3371893 CTCCCCTCATCTTGAGGGGGAGG + Intronic
969225127 4:5791545-5791567 CTGCCCTCCTCCAGACTAGAAGG - Intronic
969239037 4:5887771-5887793 TTTCCCTCCTCCAGCGGGGGAGG + Intronic
969323999 4:6430457-6430479 CTCCCCCACTCCAGAGTGCTGGG + Intronic
969721602 4:8895393-8895415 CTCCCCTGCCCCACACTGGGAGG - Intergenic
972279309 4:37587078-37587100 CTTCCCTCTTCCAGCTTGGGGGG + Intronic
972777215 4:42252674-42252696 CTCCTCTACTCAAGTGTGGGTGG - Intergenic
976971551 4:91108918-91108940 CTGCCCTCACCCAGTGTGGGTGG + Intronic
982171136 4:152662802-152662824 CTGCCTTCCTCCACAGTGGCTGG - Intronic
985765587 5:1777778-1777800 CTCCCGGCCCCCAGACTGGGAGG + Intergenic
986393680 5:7306832-7306854 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
986611403 5:9571468-9571490 CATCCCACATCCAGAGTGGGGGG - Intergenic
987062528 5:14256336-14256358 CGCCCCACCTCCAGCATGGGAGG + Intronic
987243934 5:16029183-16029205 ATCCCCTCCTCCAGAATGCATGG + Intergenic
988929930 5:36027866-36027888 CTTCCCTCCTCCAGGATGGTAGG - Intergenic
989191086 5:38670460-38670482 CTCCCCTCCCCCAGAGACAGAGG + Intergenic
991199103 5:63970468-63970490 GCCTCCGCCTCCAGAGTGGGTGG + Intergenic
994959772 5:106584408-106584430 CTCCCCTCCCACAGAGATGGAGG + Intergenic
999753716 5:154648821-154648843 CCCCTCCCCTCCAGAGTGGCTGG + Intergenic
1000273075 5:159705310-159705332 CTCTCCTCCCCCAGAGGTGGTGG + Intergenic
1000371137 5:160537863-160537885 GTCTCATCCTCCAGAGTGGCTGG + Intergenic
1001075109 5:168620691-168620713 CTCCCCACCTCCAGAAAGAGGGG - Intergenic
1001677434 5:173530343-173530365 CTTCCCTTATCCAGAGTTGGCGG + Intergenic
1001781342 5:174371517-174371539 CTCACACCCTCCAGATTGGGAGG - Intergenic
1002314946 5:178337500-178337522 CTCCACACATCCAGAGTGGGTGG + Intronic
1002772304 6:300449-300471 CTCCCTACCTCCAGACTGAGTGG - Intronic
1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG + Intergenic
1004637336 6:17481813-17481835 CTCCCCTCCTCCAAAGTCTAAGG + Intronic
1005871366 6:29976392-29976414 CTCCCCTGCCCCAGAAAGGGAGG - Intergenic
1006361410 6:33589353-33589375 CTGCCCTGCTGCAGAGTGGAGGG + Intergenic
1007122594 6:39395714-39395736 CTCCTCTACTCCAGTGTGGGTGG + Intronic
1007423596 6:41734031-41734053 CTCCCCCCATCCCGAGTGAGGGG - Intronic
1007451071 6:41940853-41940875 CTCCCCTCCCCCACAGCGAGGGG + Intronic
1007603838 6:43102092-43102114 CCACCCACCTCCAGAGTTGGAGG - Intronic
1007765457 6:44157168-44157190 CAGCCCTCCCCCAGGGTGGGAGG + Intergenic
1011625575 6:89280648-89280670 CTCAGCTCCAGCAGAGTGGGCGG + Intronic
1014295696 6:119614385-119614407 CACCACTCTTGCAGAGTGGGAGG + Intergenic
1018429988 6:163714573-163714595 TTCCCAGCCTCCAGAGTGTGAGG + Intergenic
1019611747 7:1940218-1940240 CTCCCCTGGGCCTGAGTGGGTGG - Intronic
1021786779 7:24160079-24160101 CTTCCCACCTCCTGAGTGGAAGG + Intergenic
1023095787 7:36658449-36658471 ATCCTCTCATCCAGAGTGTGCGG + Intronic
1023345846 7:39270540-39270562 CTCTTCTCCTGCAGAGTGGAAGG + Intronic
1023914026 7:44575005-44575027 CTCCCTTCCTCCAGCAAGGGTGG - Intronic
1023941250 7:44769460-44769482 GTTCCCTCATCCAGAGAGGGCGG - Exonic
1024606673 7:51027727-51027749 CTTCCCTCCCGCAGAGTGGATGG + Exonic
1026748261 7:73029492-73029514 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026751909 7:73057637-73057659 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026755558 7:73085764-73085786 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1026977660 7:74508214-74508236 GTCCCCTCCTCTTGGGTGGGTGG - Intronic
1027034463 7:74914806-74914828 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1027091842 7:75307623-75307645 GTCCCCGCCTCCTGAGTGGCTGG + Intergenic
1027095485 7:75335590-75335612 GTCCCCGCCTCCTGAGTGGCTGG + Intergenic
1027323856 7:77032093-77032115 GTCCCCGCCTCCTGAGTGGCTGG - Intergenic
1027872100 7:83720344-83720366 AGCCCCTCATCCAGAGTGAGTGG - Intergenic
1028840250 7:95421678-95421700 CTCCCCTCCCCTAGACTGGTTGG - Intronic
1029284544 7:99456767-99456789 CTCCCCTCATCCAGGGAGGGAGG + Exonic
1029479282 7:100803095-100803117 CTTGCCAGCTCCAGAGTGGGGGG - Exonic
1029538430 7:101169161-101169183 CTCCCCCACTCAGGAGTGGGTGG - Intergenic
1029600144 7:101558595-101558617 CTCCCACCTTCCAGAGTTGGGGG + Exonic
1031818209 7:126466770-126466792 CACCCCTCCACCAGTGTGGGTGG - Intronic
1031966724 7:128032345-128032367 CTCCGCTCGTCTAGAGGGGGCGG - Intronic
1033390632 7:140924561-140924583 CTCACCTCCTCCGGAATGGCAGG + Exonic
1034529846 7:151688905-151688927 CCCCTCTCCTCCAGGGTGGCCGG + Intronic
1037571525 8:20162055-20162077 CTTGCACCCTCCAGAGTGGGAGG + Intronic
1037636357 8:20704062-20704084 CTCCCCTCCTCTAGAATATGGGG - Intergenic
1037751306 8:21684173-21684195 GTGCCCTCCTCCAGGGAGGGAGG + Intergenic
1037825119 8:22156232-22156254 CTCCCCCTCTTCAGAGTGCGGGG - Intronic
1038024428 8:23576125-23576147 TTCCCCTCCTCTGGGGTGGGCGG + Intergenic
1038406597 8:27326706-27326728 TCCCCCTCCCCCAGAGTGGTTGG - Intronic
1038589837 8:28826573-28826595 ATCCTCTCCTCCTGAGTGTGAGG + Intronic
1038723748 8:30060792-30060814 CTTGACTCCTCCAGGGTGGGTGG + Intergenic
1039049790 8:33482919-33482941 CTCCTCCCCTCCAGTGAGGGTGG + Intronic
1039790543 8:40872439-40872461 CTCTCCTTCTCCAGGGTTGGGGG - Intronic
1040444834 8:47483009-47483031 CTCTGCCCCTCCACAGTGGGTGG + Intronic
1044651442 8:94499932-94499954 CTCACCTCCTCCCGAGTAGCTGG - Intronic
1045696573 8:104815559-104815581 ATCTCCTCCTCCAGAGTAGCTGG + Intronic
1046775330 8:118158445-118158467 CTCCCCTCTTTCTGAGTTGGAGG + Intergenic
1049164041 8:141115835-141115857 CTCCCCTCCCCCAGCCTGAGGGG - Intergenic
1049297939 8:141853171-141853193 CTCACCTCCTCCAGGGTGCTGGG - Intergenic
1049302759 8:141880345-141880367 CTCCCCTCCCCCAGTGTGTGGGG + Intergenic
1050689369 9:8207977-8207999 CTCCACTCCTCCACAGAAGGCGG - Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1057799579 9:98182078-98182100 CTCTCCTCCTCCAGATTCTGTGG + Intronic
1060298697 9:122361049-122361071 CTCCTCTCCTCACGAGTGGGTGG + Intergenic
1061782172 9:133002806-133002828 CTCCCCAACCCCAGACTGGGAGG - Intergenic
1062188072 9:135229195-135229217 CTCTGCTGCTCCAGAGTGAGAGG + Intergenic
1062231413 9:135484096-135484118 CTCCCCTCTTACAGAGAAGGTGG + Intronic
1062672117 9:137717066-137717088 CTCCCCTCCCCAAGGGTGGCTGG - Exonic
1203468241 Un_GL000220v1:105768-105790 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1203476062 Un_GL000220v1:149740-149762 CGCCCCTTCCCCGGAGTGGGGGG + Intergenic
1188473172 X:30562737-30562759 CTCACTTTCTCCAGAGTGGTGGG - Intronic
1189470887 X:41313248-41313270 CTCCCCACCTCCTGAGTAGCTGG + Intergenic
1189537434 X:41950203-41950225 CTCCTCCCCTTGAGAGTGGGAGG + Intergenic
1190284140 X:48951024-48951046 CTACCATCCTCCAGGGTGGGAGG + Intronic
1194756040 X:97741201-97741223 AGCCCCTTCTCCAGAGAGGGAGG - Intergenic
1196752599 X:119131248-119131270 CCCCTCTCCTTCAGTGTGGGTGG + Intronic
1202366220 Y:24167899-24167921 CTCCCCTCTCCCAGATTGGGCGG + Intergenic
1202504561 Y:25502224-25502246 CTCCCCTCTCCCAGATTGGGCGG - Intergenic