ID: 1160968549

View in Genome Browser
Species Human (GRCh38)
Location 19:1757361-1757383
Sequence CAGTCTCAGCTCTGGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160968546_1160968549 -1 Left 1160968546 19:1757339-1757361 CCTGACTTGTGACAATGACAAAC 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG 0: 1
1: 0
2: 2
3: 33
4: 264
1160968543_1160968549 17 Left 1160968543 19:1757321-1757343 CCGTTTGTGCCTCGCCTTCCTGA 0: 1
1: 0
2: 0
3: 24
4: 272
Right 1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG 0: 1
1: 0
2: 2
3: 33
4: 264
1160968544_1160968549 8 Left 1160968544 19:1757330-1757352 CCTCGCCTTCCTGACTTGTGACA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG 0: 1
1: 0
2: 2
3: 33
4: 264
1160968545_1160968549 3 Left 1160968545 19:1757335-1757357 CCTTCCTGACTTGTGACAATGAC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG 0: 1
1: 0
2: 2
3: 33
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160968549 Original CRISPR CAGTCTCAGCTCTGGGAGTC TGG Intronic
900380135 1:2379875-2379897 CAGTCTCACCTCTGGGGCTGTGG + Intronic
900409571 1:2506615-2506637 GAGTCTCAGCTCTGGGACAGGGG + Intergenic
901661329 1:10799651-10799673 CAGTCCCTGCACTGGGAGTTTGG - Intergenic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
902805733 1:18860251-18860273 GAATCTCAGCTCTGCTAGTCAGG - Intronic
903806044 1:26006243-26006265 CAGTCTGAGTTCTGGGAACCAGG + Intergenic
904090612 1:27942379-27942401 CGGTCTCAGCTCAGGGACTTGGG + Intronic
904318886 1:29683757-29683779 CAGTCTTACCTCTGGGTGCCTGG + Intergenic
905446173 1:38029768-38029790 GCCTCTCATCTCTGGGAGTCAGG + Intergenic
905641833 1:39595332-39595354 CAGTGTCAGCTCCAGGATTCAGG - Intergenic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
909431085 1:75588477-75588499 CAATCTCAGCTCTGTGATTTTGG - Intronic
911789637 1:101997014-101997036 CATTCTCAGAGCTAGGAGTCCGG + Exonic
914343448 1:146778838-146778860 CATGCTCAGCTATGGGAGGCGGG + Intergenic
915038434 1:152947712-152947734 AAGGCTCTGCTCTGGGAATCAGG + Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915470103 1:156120833-156120855 CGGTCAGAGCTCTGGGAGGCTGG + Intronic
916075409 1:161197595-161197617 CACTCCCAGCTATAGGAGTCAGG - Intronic
917274418 1:173316968-173316990 CAGTCCCATCTCTGTGAATCTGG + Intergenic
918636741 1:186783797-186783819 CAGTTCCAGCTCTGCCAGTCTGG - Intergenic
919786852 1:201263598-201263620 CAGTCTCAGAGGTGGGAGTGGGG + Intergenic
920106416 1:203556445-203556467 CAGGCGCAGCTCAGGGAGCCAGG + Intergenic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
920443006 1:205994054-205994076 CAAGCTCAGCTCTGGGAGTTGGG - Intronic
920705545 1:208248096-208248118 TGGTCTCAGCTTTGGGAGCCAGG - Intergenic
920729967 1:208474161-208474183 CAGTCTTTGCTTTGGGAGACTGG + Intergenic
920777325 1:208952466-208952488 CAGTCTGAGGTCTGGGAGTGAGG + Intergenic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
922966844 1:229697600-229697622 CAGTCTCAAGTCTGGGCTTCTGG + Intergenic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
923545709 1:234921831-234921853 CAGTCACAGCTCTGGGCTTTGGG - Intergenic
924438310 1:244065491-244065513 CTGGCTCACCTATGGGAGTCGGG + Intergenic
1062919825 10:1271364-1271386 CAGTCACTGCTCTGAGAGGCAGG - Intronic
1063901282 10:10734812-10734834 CAGCCTCAGCACTGAAAGTCCGG + Intergenic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1064960921 10:20964251-20964273 AAGCCTCAGCTCTGGGACTCTGG + Intronic
1066298874 10:34079476-34079498 CACTCTCAGCTCAGGGTGTGGGG + Intergenic
1067154092 10:43760473-43760495 CAGCCTGAGCTCAGGGAGTGGGG - Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1067363438 10:45602489-45602511 CATTCTGAGATCTGGGAGTTAGG - Intergenic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1073160862 10:101393394-101393416 CAGTCACAACTCTGGGCCTCTGG - Intronic
1073214085 10:101827094-101827116 CACTCTCAACACTGGGTGTCAGG + Intronic
1075360451 10:121827561-121827583 CAGTATCAGTTCGGGGACTCAGG - Intronic
1075811441 10:125227565-125227587 CAATTTAAGCTCAGGGAGTCTGG - Intergenic
1077174028 11:1180703-1180725 CAGTCCCGCCTCTGGGACTCAGG - Intronic
1077904507 11:6519506-6519528 AACTCTCAGGTCTTGGAGTCTGG - Intronic
1079414612 11:20222114-20222136 CAGTCTCTCCTCTGAGAGCCTGG + Intergenic
1079613902 11:22467183-22467205 CAGCATCAGTTCTGGAAGTCAGG - Intergenic
1083230186 11:61312533-61312555 GAGTCTCAGCTCTGTTATTCAGG + Intronic
1083899287 11:65635957-65635979 CACTGTCAGCTCTGGGGGTAAGG - Intronic
1084013896 11:66367641-66367663 CAGTGTCTTCTCTGGGGGTCAGG + Intronic
1084544688 11:69809036-69809058 GAGTCTCAGCTCTCTGACTCTGG + Intergenic
1084582096 11:70030344-70030366 CAGTCTGGGCTCAAGGAGTCCGG - Intergenic
1087363460 11:97189725-97189747 GAGTCTTAGCTGTGGGTGTCAGG + Intergenic
1088884032 11:113993227-113993249 CAGTATCAGCTCTGGAAGTTGGG + Intergenic
1089133555 11:116231372-116231394 CAGACTCTGCTTGGGGAGTCAGG + Intergenic
1089300327 11:117494959-117494981 CTGTCACAGTTCTGGGAGGCTGG - Intronic
1089536028 11:119161265-119161287 CAGCCTGGGCTCTGGGAGTGGGG + Exonic
1090256931 11:125291095-125291117 CAGACCCAGCTCTGGCAGGCTGG + Intronic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092231728 12:6779418-6779440 CAGCTGCAGCTGTGGGAGTCGGG + Intergenic
1092279826 12:7090595-7090617 CTGTCTGAGCTCTGGGAATGAGG - Intronic
1092756636 12:11769875-11769897 GAGTCACAGCTCTGGGCTTCAGG - Intronic
1093414543 12:18905248-18905270 CAGTCTCAGCTAGGCGTGTCTGG - Intergenic
1095227601 12:39695622-39695644 CTGTCTCAGAACTGGGAGTCAGG - Intronic
1096478906 12:51924933-51924955 CAGTCCCAGCCCTGGGAGACTGG - Intergenic
1096490189 12:52008809-52008831 CTGCCTCAGCTTTGGGAGTCTGG + Intronic
1097564920 12:61254944-61254966 CACACTCATCTCTGAGAGTCAGG + Intergenic
1098864419 12:75745763-75745785 GAGTCTAAGCTCTGGGGGTATGG - Intergenic
1100588290 12:95999638-95999660 GAGTCTCACCTCTGGGAATTTGG + Intergenic
1101733908 12:107448664-107448686 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1102713868 12:114952907-114952929 CCGTGTCTGCTCTTGGAGTCAGG + Intergenic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1104759047 12:131286223-131286245 CCGTCTCAGCTCTGGGATTGGGG - Intergenic
1104821562 12:131680273-131680295 CCGTCTCAGCTCTGGGATTGGGG + Intergenic
1104936199 12:132365677-132365699 AAGCCTCAGCTCTGGGTTTCTGG + Intergenic
1104936223 12:132365795-132365817 AAGCCTCAGCTCTGGGTTTCTGG + Intergenic
1104936248 12:132365913-132365935 AAGCCTCAGCTCTGGGTTTCTGG + Intergenic
1106100338 13:26689854-26689876 CAGACTGAGCTCTGGGAGGCAGG + Intergenic
1106225581 13:27783950-27783972 CAGGCTCAGCTCACGGACTCAGG + Intergenic
1108118350 13:47155566-47155588 CAGTCTGACCTTTGAGAGTCAGG + Intergenic
1112365599 13:98752702-98752724 CAGCCCCAGCTCTGCGAGGCGGG + Intergenic
1112804495 13:103148429-103148451 CAAACTCTGCTCTGGGTGTCTGG + Intergenic
1114192746 14:20452734-20452756 CAGTCTCAGCTCTGTCACCCAGG + Intronic
1114962918 14:27917962-27917984 AAGTCTCAGCTCTTAGAGCCTGG + Intergenic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1121091228 14:91184143-91184165 CTGTCTGGGCCCTGGGAGTCTGG - Intronic
1121420193 14:93807787-93807809 CAGCCTCAGCTCTGGAAGGCAGG + Intergenic
1122373124 14:101240282-101240304 CCTTCCCAGCTCTTGGAGTCAGG - Intergenic
1122525026 14:102375745-102375767 CAGTCACAGCTCTGACAGGCAGG - Intronic
1122805895 14:104256833-104256855 GAGTCTGGGCTCTGGGAGGCTGG + Intergenic
1122892050 14:104736569-104736591 CAGGCTCAGCTGAGGGAGACGGG - Intronic
1123103177 14:105819303-105819325 GAGTCACAGTTCTGGGAATCTGG + Intergenic
1124226650 15:27900981-27901003 CAGAATCAGCTCTGGAAGCCGGG + Intronic
1125144086 15:36445957-36445979 CAGTCTGAGCTCTAGGTTTCAGG - Intergenic
1125754112 15:42050706-42050728 CAGCCTCCTCTCTGGGACTCAGG + Exonic
1129857293 15:78833651-78833673 CAGTGTCAGTTCTAGGAGTCAGG + Intronic
1130935494 15:88467281-88467303 CAGTCTAAGCTCTCGCAGCCTGG - Exonic
1132183306 15:99779287-99779309 CAGTCACAGGTCTGGGAATGAGG + Intergenic
1132435128 15:101794194-101794216 CAGTCACAGGTCTGGGAATGAGG - Intergenic
1133270291 16:4608064-4608086 CAGTCACATCCCTGGGAGCCAGG + Intergenic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1133862615 16:9610413-9610435 CTCTCTGAGCTCTGGGAGCCAGG - Intergenic
1138542277 16:57695707-57695729 CATTCTGTGCTCTGGGACTCAGG - Intronic
1139990542 16:70936496-70936518 CATGCTCAGCTATGGGAGGCGGG - Intronic
1140805348 16:78527519-78527541 CAGTCTCATCACTTGAAGTCAGG - Intronic
1141414067 16:83856466-83856488 CTGTCACAGCTCTGTGAGTGTGG - Intergenic
1141895032 16:86953830-86953852 CGCTCTCAGCTCAGGGTGTCCGG - Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1143423312 17:6813040-6813062 CTGTTTCAGCTCCGTGAGTCTGG - Exonic
1145099812 17:20065330-20065352 CAGTCTCAAGTCTGGGCCTCTGG + Intronic
1145936739 17:28718511-28718533 TGGTCTCCGCTCTGGGAGGCGGG + Intergenic
1146266140 17:31454094-31454116 CAGTCTCTGCCCTGGGAGAATGG - Intronic
1146715635 17:35084566-35084588 CAGTCTCAGCTCTGTCATCCAGG - Intronic
1147627477 17:41909405-41909427 CGGTCTCCTCTCTGGGAGCCAGG - Intronic
1150487833 17:65556293-65556315 TAGTCTCAGCTCTGGCTGCCAGG + Intronic
1151379785 17:73717738-73717760 CAGGCCCAGCGCTGGGAGGCTGG - Intergenic
1151816586 17:76474238-76474260 CAGTCTCATCTATGGGGGTCTGG + Intronic
1152108514 17:78344019-78344041 CAGTCCCAGCTCTGGGCAGCAGG - Intergenic
1152578069 17:81151601-81151623 CAGTTCCAGCTCTTGGGGTCAGG - Intronic
1153997634 18:10455185-10455207 CCGTCTCAGCCCTGGGAGAGGGG + Intronic
1154217924 18:12429063-12429085 CAGCCTCAGCGCTGGGATTTGGG + Intronic
1155033740 18:22006267-22006289 CAGAAAAAGCTCTGGGAGTCTGG + Intergenic
1155109834 18:22703280-22703302 CTGTTTCAGCTCTAGGAATCTGG - Intergenic
1155416632 18:25605828-25605850 AAGCCCCAGCTCTGGGAATCTGG - Intergenic
1155931595 18:31714521-31714543 CAGTCCCTGCTTTGGGACTCTGG + Intergenic
1155988138 18:32252505-32252527 GGGTCTCAGCTCTGGCAGTCTGG + Intronic
1156925434 18:42572264-42572286 CACTCTCACCTCTGAAAGTCTGG - Intergenic
1157225327 18:45857893-45857915 GAGACTCAGCTCTGGGATCCTGG - Exonic
1157951819 18:52046975-52046997 AAGACTCAGGCCTGGGAGTCAGG + Intergenic
1159453340 18:68630246-68630268 ATGTCTCAGTTCTGGGAGTATGG - Intergenic
1160910247 19:1470768-1470790 CAGCCCCAGCTGTGGGAGTGCGG + Exonic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1162207399 19:9065926-9065948 CAGGCTCAGCTGCGGGTGTCAGG + Intergenic
1163486622 19:17591396-17591418 CAGATGCACCTCTGGGAGTCTGG - Intergenic
1163557731 19:18001992-18002014 CAGTCTAAGTTGAGGGAGTCTGG - Intronic
1164745795 19:30611927-30611949 CAGTGGCAGCCCTGGGAGTTAGG + Intronic
1165886901 19:39084799-39084821 CACTCTCAGTGCTGGGGGTCTGG - Intronic
1167262533 19:48467272-48467294 CTCTCTCAGCTCAGGGTGTCTGG + Intronic
1168400526 19:56083753-56083775 CAGACTCAGCTGTGGGGGTGGGG + Intergenic
925616780 2:5751331-5751353 CATTCTGAGCTCTAGGAGTACGG - Intergenic
926361902 2:12096560-12096582 CTGTCTCAGCTATGGGGCTCTGG - Intergenic
928376806 2:30781591-30781613 GTGTCTCAGCTCAAGGAGTCAGG - Intronic
929040935 2:37743747-37743769 AAGTCCAGGCTCTGGGAGTCTGG + Intergenic
929589874 2:43137925-43137947 CAGGCTCTGCTCTGAGAGCCAGG - Intergenic
930447375 2:51490885-51490907 TAGTATCAGCTCTGTGATTCTGG - Intergenic
930892251 2:56403990-56404012 CAGTCAGAGCTCTTGGACTCAGG - Intergenic
931737108 2:65205911-65205933 CACTCTCTGCTCTGGTAGACGGG + Intergenic
931767892 2:65472944-65472966 CACTCACAGCTCTGTGAGTGAGG + Intergenic
935634140 2:105237100-105237122 CAGTTTCAGCGCTGGGAGGAAGG + Intergenic
937071502 2:119067184-119067206 AAGGCTCACCCCTGGGAGTCAGG + Intergenic
937767592 2:125679997-125680019 CAGCATCAGCTCTGGTAGTATGG + Intergenic
937986708 2:127641303-127641325 CAGCCTCAGCCCCAGGAGTCAGG + Intronic
941804149 2:169693935-169693957 CAGTTGCAGCTCTGAGAGTCTGG - Intronic
942725739 2:179005727-179005749 TAGTCCCAGCTATGGGGGTCGGG - Intronic
944904314 2:204247269-204247291 CAGGCTCAGTTATGGGAGTGGGG + Intergenic
945417954 2:209598333-209598355 CAGTCTCTGCACTGGGTGCCGGG - Intronic
945472339 2:210241308-210241330 CATCCCCAGCTCTGGGAGTGTGG - Intergenic
947634518 2:231673298-231673320 GAGACTCAGATCTGGGAGGCCGG + Intergenic
948927790 2:241110581-241110603 GAGCCACAGCTCTGGGAGGCAGG + Intronic
1168790368 20:572134-572156 GAGTCTCAGCGCTGGGAGGAGGG + Intergenic
1169252204 20:4069329-4069351 CAGCCTCAGCTCTAGGGTTCAGG + Intergenic
1169617284 20:7462806-7462828 CAGTCACTGCTCTGGAAGACAGG - Intergenic
1171413314 20:24960706-24960728 CAGTCACATCCCTGGGAGGCTGG + Intergenic
1172070389 20:32252423-32252445 CTGTCTCAGGTCTGGGGGTGGGG - Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1173000109 20:39099413-39099435 GAATCCCAACTCTGGGAGTCTGG - Intergenic
1173707608 20:45124075-45124097 CAGCCCCAGCCCTGGGAGGCAGG + Intronic
1173945009 20:46943557-46943579 GAGTCTCAGATCTGGGATTTGGG + Intronic
1174361069 20:50029315-50029337 CAGGCGCAGCTGGGGGAGTCAGG + Intergenic
1176373165 21:6074592-6074614 CACTGGCAGCTCTGGGAGCCCGG + Intergenic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179426287 21:41281106-41281128 CTGTCTCTCCTCTGGGAATCAGG + Intronic
1179750312 21:43463651-43463673 CACTGGCAGCTCTGGGAGCCCGG - Intergenic
1181104473 22:20565638-20565660 CACTGTCAGCTCTGGGAGAGGGG - Intronic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183234357 22:36606191-36606213 AAGACTCAGCTCTGGGGGACGGG - Intronic
1183387842 22:37525310-37525332 CAGTCTCAGCGATGGGAGCCAGG - Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183705398 22:39472427-39472449 CAGTAGCCCCTCTGGGAGTCGGG + Intronic
949426913 3:3927775-3927797 GAGTCTCAGCTCTGCAAGTTAGG - Intronic
952814524 3:37435662-37435684 CAGTCTCAGATCTGAGAGGCGGG - Intergenic
953885409 3:46712158-46712180 CTGTCACAGCCCTGAGAGTCAGG - Exonic
953930652 3:47004240-47004262 CAGGCTGGGGTCTGGGAGTCTGG - Exonic
954363941 3:50136546-50136568 GAGACTCAGCTCTGGGAGGACGG - Intergenic
955093664 3:55776007-55776029 CTGTCTCAGCTCAGTGAGACTGG - Intronic
960796338 3:121492141-121492163 AGGTCTCAGAGCTGGGAGTCAGG + Intronic
961001308 3:123375912-123375934 GAGTCCCAGCTCTGGGACTGTGG - Intronic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
961386195 3:126524640-126524662 CAGTCACCGCTCTGGGAGTGGGG - Intronic
961598618 3:128041543-128041565 TATTCTCAGCTCTGGGGTTCTGG + Intergenic
961666986 3:128498720-128498742 CAGTCGCAACTCTGGGAATGAGG + Intergenic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
962736159 3:138327464-138327486 GAATCTCAGCCCTGGGAGCCAGG + Intronic
964260358 3:154828549-154828571 CAGTCTCCTCTCTGGAATTCAGG - Intergenic
966218905 3:177531098-177531120 CCTTCTCAGCTCTGCAAGTCCGG - Intergenic
966816957 3:183897115-183897137 AACACTCAGCTCTGGGATTCCGG + Intergenic
970256885 4:14177465-14177487 CAGGCTGACCTCTGGGAGTAAGG + Intergenic
971198200 4:24489083-24489105 CACTTTCAGCTCTGGGATCCTGG - Intergenic
972730076 4:41785729-41785751 CAGTCTCTGTTAGGGGAGTCAGG + Intergenic
974366850 4:60961353-60961375 CAGTCCCAGCTCTGGGAGTTAGG - Intergenic
976916104 4:90376423-90376445 CAGGCTCAGCTTTGGAAGTAAGG - Intronic
978112248 4:104977160-104977182 CAGTCACAGCCATGGGAGGCAGG + Intergenic
983961380 4:173759282-173759304 CATTCTCAGAACTGGGAGACAGG + Intergenic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
984635687 4:182106798-182106820 CAGTATCAGCTGTGGGAAACTGG + Intergenic
986009348 5:3698345-3698367 CAGCCCCAGCCCTGGGAGTGGGG - Intergenic
986096014 5:4554774-4554796 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096022 5:4554840-4554862 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096031 5:4554892-4554914 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096043 5:4554958-4554980 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096048 5:4555010-4555032 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096061 5:4555104-4555126 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986096077 5:4555216-4555238 CAGTTTAGGCTCTGGGAGACAGG - Intergenic
986278976 5:6306889-6306911 CAGTCCCAGCTCATGGAGTCTGG - Intergenic
986314620 5:6578258-6578280 CAGTCCCAGCTTTGTGACTCAGG + Intergenic
987121982 5:14776328-14776350 GAGAGTCAGCTCTGTGAGTCTGG + Intronic
988373815 5:30407471-30407493 CAGTTTCAGAGCTGGGAGTCAGG + Intergenic
993495101 5:88600002-88600024 CAGTCTGTGGCCTGGGAGTCAGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993920501 5:93795100-93795122 CAGTCTCTCCTCTGGCAGGCTGG + Intronic
995421993 5:111978093-111978115 TAGTCTCAGTTGTGGGAGGCAGG + Intronic
996408137 5:123126993-123127015 CAGTCTAAGTTCTGGGAGCCAGG - Intronic
996849606 5:127937551-127937573 AAGTCTCAGATCAGGGTGTCAGG - Intergenic
997566247 5:134889006-134889028 CAGTCACAGCTCTTAGAGTCAGG - Intronic
999077243 5:148807815-148807837 CAGTCCCAGCTTTAGGATTCTGG + Intergenic
999341900 5:150779749-150779771 CATTCTCAGCTCTTGGAGCAGGG + Intronic
999845393 5:155473995-155474017 CAGGCTCAACACTGGTAGTCTGG + Intergenic
1003092940 6:3119061-3119083 CAGCCTCAGTTCAAGGAGTCTGG + Intronic
1003585791 6:7388134-7388156 CACTCTCAGCTCTGGAGCTCTGG - Intronic
1005262861 6:24080329-24080351 CAATATCAGCTCTGGGAATGGGG + Intergenic
1006579783 6:35070217-35070239 CATTTTCAGCTCTTGCAGTCTGG + Intronic
1007252085 6:40502665-40502687 CTGTCTGGGCTCTGGGAGACAGG - Intronic
1008132054 6:47729741-47729763 CCGTCTGGGCTCTGGGAGTTGGG + Intergenic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011714691 6:90093000-90093022 CTGTCTCATCTCTGGGAGTTGGG - Intronic
1012129985 6:95478128-95478150 CAGATTCAGCCCTGGCAGTCTGG - Intergenic
1012445933 6:99307179-99307201 TAGTAGCAGGTCTGGGAGTCAGG + Intronic
1012473134 6:99592435-99592457 AAGTTTCACCTCTTGGAGTCTGG + Intergenic
1013108052 6:107042793-107042815 TAGTCTCTGCACTGGGAGTCAGG + Intronic
1014746560 6:125207778-125207800 GAGTCTCTGATCTAGGAGTCTGG + Intronic
1016289980 6:142518434-142518456 CAGCATCAGCTCTGGTAGTATGG + Intergenic
1017539430 6:155385236-155385258 CAGTCACAGGCCTGGGTGTCGGG - Intergenic
1017629886 6:156386453-156386475 AAGTCTCAGCTATGGGGGTATGG + Intergenic
1017693535 6:156991139-156991161 CAGTTTCAACCCTGGCAGTCTGG + Intronic
1018781110 6:167066457-167066479 CAGTCGCAGGTCTGGGCCTCTGG - Intergenic
1018838248 6:167501090-167501112 CAGTCTCAGCTGTGAGACTGAGG - Intergenic
1019729772 7:2623488-2623510 CAGTCTCAGCTCTGGAGGCTCGG - Intergenic
1019750567 7:2726553-2726575 TAGGCTGAGCTCTGGGAGCCTGG - Intronic
1021408319 7:20299867-20299889 CTGCTTCAGCTCTGAGAGTCAGG + Intergenic
1022029791 7:26481720-26481742 CAGACTCACCTCTGTGAGGCTGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024306279 7:47932182-47932204 CAGGCTCATTCCTGGGAGTCAGG + Intronic
1025198257 7:56948045-56948067 TAATCTCAGTTCTGGGAGGCCGG - Intergenic
1025673692 7:63628888-63628910 TAATCTCAGTTCTGGGAGGCCGG + Intergenic
1025819394 7:64947905-64947927 CAGTCTCGGCTCGGGGAGCCCGG - Intergenic
1029664207 7:101984006-101984028 CAGTCTCAGCTCTGTCACCCAGG - Intronic
1030141217 7:106305919-106305941 TAGTCTCAGCCCTGTGAGTCAGG - Intergenic
1032298664 7:130667711-130667733 AAGTCTCAGCTCTTCGAGTATGG - Intronic
1032772597 7:135074367-135074389 CACTCTCAGTTCTTGAAGTCTGG - Intronic
1033665283 7:143435485-143435507 ATGTCTCAGATCTTGGAGTCAGG - Intergenic
1034747304 7:153534501-153534523 CAGTCCCAGCTCAGACAGTCAGG + Intergenic
1035612897 8:980099-980121 CAGACTCAGAGCTGGGATTCCGG + Intergenic
1037782119 8:21877002-21877024 GAGTCTCTGCACTGGGTGTCTGG - Intergenic
1039881645 8:41628978-41629000 CAGACTCAGCTCTGGATGGCTGG + Intergenic
1040957460 8:52994458-52994480 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1041182413 8:55262669-55262691 CTCTCTCAGCTCTGGAAGCCGGG - Intronic
1043923804 8:86014310-86014332 GAGTCAGAGCCCTGGGAGTCTGG - Intronic
1044856498 8:96481460-96481482 TAATCTCAGCTTTGGGAGGCAGG + Intergenic
1047705905 8:127499408-127499430 CAGTCACAGCTGTGGGAATGAGG + Intergenic
1047940617 8:129824779-129824801 CTGACTCTGCTGTGGGAGTCTGG - Intergenic
1049399702 8:142419458-142419480 CAGGCCTAGCTCTGGGACTCAGG - Intergenic
1051486134 9:17610072-17610094 CAGTTTTAACTCTGTGAGTCTGG + Intronic
1053017436 9:34670696-34670718 CAGTCTCAAGGCTGGGAGTCAGG + Intergenic
1055660235 9:78496036-78496058 CTCTCTCAGATCTGAGAGTCTGG - Intergenic
1055847507 9:80584606-80584628 CAATCTTGGGTCTGGGAGTCAGG - Intergenic
1056652367 9:88477212-88477234 CAGTCTGGACTCTGGGAGCCAGG - Exonic
1056762297 9:89424188-89424210 CAGTCTCATCTCTGGTGGTAGGG - Intronic
1057197291 9:93122116-93122138 CAGCCTGGGCTCTGGCAGTCTGG + Exonic
1058180868 9:101797157-101797179 CAGTCTCAGCTCTGTCACCCAGG + Intergenic
1058843574 9:108934104-108934126 CAGCCGCAGCACTGGGAGTGCGG + Exonic
1059869669 9:118558235-118558257 CAGTCTCAGCTCAGTGATTAAGG + Intergenic
1060239764 9:121892862-121892884 CAGTGTCAGGTCTGGCAGTCAGG + Intronic
1060765937 9:126295042-126295064 GAGTCCCAGCTATGGGAGGCAGG - Intergenic
1060806875 9:126583267-126583289 CTCTCACAGCTCTGGGAGCCAGG - Intergenic
1060811161 9:126612317-126612339 CAGATTCACCCCTGGGAGTCTGG + Intergenic
1060977125 9:127771321-127771343 CAGTCTCCGCCCCCGGAGTCCGG - Intronic
1061588713 9:131584459-131584481 CAGTCCCTGCTCTGGGAGCCCGG - Intronic
1062061291 9:134496682-134496704 CTGTTTCAGCTCTGGGTGGCGGG + Intergenic
1062069037 9:134545548-134545570 CAGGCTGAGCTCTGGGTCTCGGG - Intergenic
1062170277 9:135131085-135131107 AAGTCTCAGTTCTGGGAAGCAGG - Intergenic
1062572322 9:137191377-137191399 CAGTGCCAGCTCTGGGAGGCTGG + Intergenic
1186958266 X:14706936-14706958 GCGTCTCAGGTCTGGCAGTCAGG - Intronic
1193636960 X:83962912-83962934 CAGCCACAGCTCTGGGATTGGGG - Intergenic
1199237493 X:145507716-145507738 CAGCCTCAAGTCTGGGACTCTGG - Intergenic
1199843167 X:151671391-151671413 CAATCTCAGCTCTTGTAGCCAGG - Intronic