ID: 1160970495

View in Genome Browser
Species Human (GRCh38)
Location 19:1765795-1765817
Sequence CACTGCAGCCATGGGGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 286}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160970495_1160970514 24 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970514 19:1765842-1765864 GAGGAGCCCACCCTGGGGCTGGG 0: 1
1: 1
2: 3
3: 51
4: 396
1160970495_1160970505 -8 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970505 19:1765810-1765832 CTGCAGTGGTGAGGGGAGCAGGG 0: 1
1: 0
2: 4
3: 74
4: 566
1160970495_1160970515 27 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970515 19:1765845-1765867 GAGCCCACCCTGGGGCTGGGCGG 0: 1
1: 1
2: 6
3: 84
4: 617
1160970495_1160970512 19 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970512 19:1765837-1765859 GCAGAGAGGAGCCCACCCTGGGG 0: 1
1: 0
2: 5
3: 46
4: 328
1160970495_1160970507 -6 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970507 19:1765812-1765834 GCAGTGGTGAGGGGAGCAGGGGG 0: 1
1: 0
2: 7
3: 132
4: 1079
1160970495_1160970513 23 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970513 19:1765841-1765863 AGAGGAGCCCACCCTGGGGCTGG 0: 1
1: 0
2: 3
3: 53
4: 412
1160970495_1160970509 5 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970509 19:1765823-1765845 GGGAGCAGGGGGAGGCAGAGAGG 0: 1
1: 2
2: 32
3: 348
4: 2611
1160970495_1160970504 -9 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970504 19:1765809-1765831 GCTGCAGTGGTGAGGGGAGCAGG 0: 1
1: 1
2: 10
3: 82
4: 649
1160970495_1160970511 18 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970511 19:1765836-1765858 GGCAGAGAGGAGCCCACCCTGGG 0: 1
1: 1
2: 6
3: 27
4: 351
1160970495_1160970508 -3 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970508 19:1765815-1765837 GTGGTGAGGGGAGCAGGGGGAGG 0: 1
1: 0
2: 26
3: 306
4: 3180
1160970495_1160970506 -7 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970506 19:1765811-1765833 TGCAGTGGTGAGGGGAGCAGGGG 0: 1
1: 0
2: 11
3: 113
4: 841
1160970495_1160970510 17 Left 1160970495 19:1765795-1765817 CCCGCGTCCCCATGGCTGCAGTG 0: 1
1: 0
2: 1
3: 17
4: 286
Right 1160970510 19:1765835-1765857 AGGCAGAGAGGAGCCCACCCTGG 0: 1
1: 0
2: 4
3: 51
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160970495 Original CRISPR CACTGCAGCCATGGGGACGC GGG (reversed) Intronic
901180892 1:7341212-7341234 TATTCCAGCCATGGGGAAGCTGG - Intronic
901194535 1:7433060-7433082 CCCTTCAGCCATGGGGACTGGGG - Intronic
902121335 1:14168553-14168575 CACTGTTGCCATGAGGAAGCTGG - Intergenic
902140240 1:14347473-14347495 CAATCCAGCCTTGGGGAGGCTGG - Intergenic
902575096 1:17372618-17372640 CTGTGAAACCATGGGGACGCTGG + Intronic
903724090 1:25428242-25428264 CACTGCAGTCATGGGGATGAGGG + Intronic
903807819 1:26017869-26017891 CACCCCAGCCCTGGGGATGCTGG - Intergenic
905329044 1:37179314-37179336 CACTTCAGCCATGGGGCAGGTGG + Intergenic
906476057 1:46170220-46170242 AACTGCAGTTATGGGGAAGCTGG + Intronic
907651172 1:56296169-56296191 CCCTGCAGAGATGGGGAAGCAGG + Intergenic
909626767 1:77725981-77726003 CACTGCAGCCTGGGGGACAGAGG - Intronic
914947817 1:152081310-152081332 CACAGCAGCCATGGAGAAGGCGG - Intergenic
915201268 1:154231198-154231220 CACTGCAGCCATGGACACCTGGG + Intronic
917968345 1:180192419-180192441 TACTGCAGGCAGGGGGAGGCAGG + Intronic
918050496 1:180968865-180968887 CATGCCAGCCATGGGGAAGCAGG - Intergenic
918060989 1:181061048-181061070 CATGCCAGCCATGGGGAAGCAGG - Exonic
920457234 1:206110395-206110417 CACAGCAGGCAAGGTGACGCAGG + Exonic
920563275 1:206954471-206954493 CACTGCAGCCAAGTAGACACAGG - Intergenic
921026261 1:211285575-211285597 CATTCCTGCCATGGGGAAGCAGG - Intronic
921158167 1:212453939-212453961 AACTGCAGCCAAGGGGGCGGGGG - Intergenic
922089228 1:222379713-222379735 CACAGCATCAGTGGGGACGCTGG - Intergenic
922738437 1:228002354-228002376 CACAGCAGCTTTGGGGAAGCAGG + Intergenic
1063351062 10:5355454-5355476 CACTGTAGACATGGGGACAGAGG - Intergenic
1063351635 10:5362181-5362203 CACATCAGCCATGGGGAGGGAGG + Intergenic
1065706774 10:28477748-28477770 CACTCCAGCCTTGGGGACAGAGG + Intergenic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1066026654 10:31364551-31364573 CACGGCAGCCATGGAGAAGGCGG - Intronic
1066223475 10:33358450-33358472 CACTGCAGCCATGGGCCCCTGGG + Intergenic
1067219684 10:44335046-44335068 CACTGCAGCTGTGGGGACCATGG - Intergenic
1067563874 10:47322739-47322761 CACTGCAGAGCTGGGGACGAGGG + Exonic
1069163920 10:65125367-65125389 CACTGCAGGAATTGGGACTCAGG + Intergenic
1069435560 10:68379431-68379453 TACTGCAGCCATGAGGCAGCTGG - Exonic
1069870106 10:71527922-71527944 CAGTCCAGCCATGGGGACCAGGG - Intronic
1070739038 10:78890240-78890262 CTCTGCAGCAATGAGGATGCTGG + Intergenic
1070774517 10:79101986-79102008 CCCTGGTGCCATGGGGAGGCTGG - Intronic
1071526562 10:86362977-86362999 CCCCGCAACCATGGGGACTCTGG - Intronic
1072203611 10:93182704-93182726 CACTGCAGCCATTTGGAAACTGG + Intergenic
1073527101 10:104193960-104193982 CTCTGCAGCCGTGGGCACGGAGG - Exonic
1074146860 10:110724613-110724635 CCCTGCAGCCATGGGCGTGCTGG + Intronic
1074358594 10:112807151-112807173 CAGTGCAGCCATGGGGAAGAAGG + Intronic
1074860140 10:117503687-117503709 CCCTGCAGGCATGGGGTCCCGGG - Intergenic
1076010452 10:126983952-126983974 CACTGCAGCCTTGGACACGTTGG + Intronic
1076248329 10:128964948-128964970 CTGTGCAGCCATGGGGTCCCAGG + Intergenic
1076522850 10:131091596-131091618 CTCTGGAGCCCTGGGGGCGCTGG + Intergenic
1076591619 10:131587455-131587477 CACTGCAGCCCTGAGGTCCCAGG + Intergenic
1076627652 10:131831834-131831856 GAGTGCAGCCCTGGGGAAGCCGG + Intergenic
1076893109 10:133294689-133294711 CACTGCAGCCTTGAGCACCCAGG + Intronic
1077230221 11:1455335-1455357 GACAGCAGCCCTGGGGAGGCAGG - Intronic
1077486442 11:2840862-2840884 CACTCCAGCCTTGGGGCCCCGGG + Intronic
1081040162 11:38200350-38200372 CACTCCAGCCTGGGGGACGGGGG + Intergenic
1082111256 11:48277416-48277438 CAGTGAAGCCATGGGGTCCCAGG + Intergenic
1083032360 11:59604777-59604799 CACTGCAGCCTTGAGCACCCAGG - Intronic
1083726504 11:64631171-64631193 CTCTGCAGCCATGGGGGTGGAGG + Intronic
1083742503 11:64718315-64718337 ACCTCCAGCCATGGGGATGCCGG + Intronic
1083810771 11:65105353-65105375 CACTGCAGCCTGGGCGACGGAGG + Intronic
1084171585 11:67403781-67403803 CACTGGGGCCATGGGGAAGGTGG + Intronic
1084177074 11:67428535-67428557 CACGGCCGCCATGGCGGCGCCGG - Exonic
1084538961 11:69774967-69774989 CACTGCACCCAACGGCACGCTGG - Exonic
1084665320 11:70573263-70573285 CACTGCAGCGGTGGGGGCGGGGG + Intronic
1084734190 11:71093935-71093957 CACTGCAGCCACGGCGCCTCTGG - Intronic
1087336151 11:96847550-96847572 GGCTGCAGCCAAGGGGACACTGG + Intergenic
1087736993 11:101845461-101845483 CACTGCAGCAATGGGAATGATGG - Intronic
1088597278 11:111449875-111449897 CACTGAAGGCATGGGGAGTCAGG + Intronic
1089041357 11:115453289-115453311 CACTGCAGCCATGAGCTCCCAGG - Intronic
1090430115 11:126638851-126638873 CACTGGGGCCATGGGGAGACGGG - Intronic
1090678684 11:129029766-129029788 CACTGCAGCCTGGGGGACAGAGG + Intronic
1091368324 11:135039696-135039718 CACTGCAGCCCTGGGGATAAGGG - Intergenic
1091393964 12:142371-142393 CTCTGCAGGCATGGAAACGCAGG - Intronic
1091603626 12:1932679-1932701 CTCTGCAGCCAGGGAGAGGCAGG - Intergenic
1091770602 12:3148819-3148841 AGCTGCAGCCGTGGGGAGGCTGG - Intronic
1092089984 12:5796689-5796711 CACTGCAGCCGGGTGGAGGCAGG + Intronic
1092180499 12:6443506-6443528 CACTGCAGGCATGGGGCAGTGGG - Intergenic
1092289179 12:7148989-7149011 CACTTCAGGGATGGAGACGCAGG - Exonic
1094089217 12:26629508-26629530 CACTGCAGCCTTGAGGTCGTGGG - Intronic
1095110975 12:38294815-38294837 CACTGCAGCCCTGGGGGCAGTGG - Intergenic
1096077824 12:48815828-48815850 GACTGCACCGATGGGGAGGCAGG + Intronic
1096085574 12:48863098-48863120 CACTGCAGCACTGGGGAAGGGGG + Intronic
1096170853 12:49468508-49468530 CACTCCAGCCTTGGTGACGGAGG - Intronic
1099354047 12:81611415-81611437 CACTGCAGCCCTGGGGAACCAGG + Intronic
1099380767 12:81949572-81949594 GACTGAAGCCAAGGGAACGCAGG - Intergenic
1100334818 12:93619184-93619206 CACCACAGCCATGGCAACGCAGG + Intergenic
1100423552 12:94460376-94460398 ATCTGCACCCATGGGGACGATGG - Intergenic
1102014221 12:109637258-109637280 CACTGCAGCCACGGTCACACTGG + Intergenic
1102202950 12:111070142-111070164 CACAGCAGCCATGGAGGCGTAGG + Intronic
1102451010 12:113042208-113042230 GACTGCAGCCCTGGTGAAGCGGG + Intergenic
1103687642 12:122744632-122744654 CACTCCAGCCTTGGTGACGGAGG + Intergenic
1103705002 12:122866680-122866702 CACTGCAGCCCTGGTGAGGGCGG - Exonic
1105357159 13:19669214-19669236 CACTGCAGCCTGGGTGACACAGG - Intronic
1105895430 13:24713259-24713281 CATTGCAGCCATGAGCACTCAGG - Intergenic
1106453706 13:29908586-29908608 GACTGCAGGCACGGGGAGGCTGG + Intergenic
1106929860 13:34652367-34652389 CAGTGCACCAATGGGGACTCTGG - Intergenic
1107559572 13:41547358-41547380 CACTGCAGCCGTGGGGGCCCTGG - Intergenic
1108470605 13:50763177-50763199 CACTGATGTCCTGGGGACGCTGG + Intronic
1108478142 13:50841702-50841724 CACTGCAGCCTTGGCAACACAGG + Intronic
1110627020 13:77663128-77663150 CACGGCAGCCATGGAGAAGGCGG - Intergenic
1110943349 13:81381133-81381155 CACAGCAGCCATGTGGAAGGGGG + Intergenic
1112046674 13:95604336-95604358 CCCTGCCGCCCTGGGGAAGCTGG + Intronic
1113355191 13:109572521-109572543 CACTGCTGCCATGGGCCCACAGG - Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113755431 13:112808101-112808123 CTCTGCATCCATGGGGGCTCGGG - Intronic
1113793816 13:113045263-113045285 CACTGCAGCCTGCAGGACGCTGG + Exonic
1113960148 13:114121694-114121716 CTCTGTAGCCCTGAGGACGCGGG + Intronic
1116075783 14:40109041-40109063 CACTCCAGCCTGGGGGACACAGG - Intergenic
1116671283 14:47846142-47846164 CACTGGAGCCATGGTGATGGCGG - Intergenic
1117736975 14:58777545-58777567 CACGGCAGCCATGGGAACCCTGG - Intergenic
1118836561 14:69482549-69482571 CACAGCAGTCATGGGGAGGTGGG - Intergenic
1119903020 14:78277338-78277360 TGCTGAAGCCATGGGGAAGCTGG - Intronic
1120601499 14:86515866-86515888 CACTGGAGCCAGGGGGTTGCTGG - Intergenic
1122747619 14:103908388-103908410 CACTGCAGCCTTGGTTACCCAGG + Intergenic
1122972397 14:105157762-105157784 CGCTGCAGACATGGGGAGGCGGG + Exonic
1123456072 15:20427417-20427439 CACTACAGCCCTGGGGACACTGG + Intergenic
1123635498 15:22303420-22303442 CACTACAGCCCTGGGGACACTGG - Intergenic
1124216000 15:27807427-27807449 CTCTGAAGACATGGGGAAGCTGG - Intronic
1124252892 15:28118684-28118706 CATCGCAGCCATGGGGTGGCGGG + Intronic
1124604940 15:31162868-31162890 CACTGCAGCCCTGGACCCGCTGG - Intergenic
1127110525 15:55664620-55664642 CACTCCAGCCATGGTGAAGTAGG - Intronic
1127447714 15:59082042-59082064 CACTGCAGCCTGGGTGACACAGG + Intronic
1128667633 15:69550140-69550162 AACTGCAGCCATTGGGAAACAGG - Intergenic
1129849496 15:78784287-78784309 CACTGCAGCCTTGGGCTCCCAGG - Intronic
1131124832 15:89850791-89850813 CACTGCAGCCATGGCCTCCCAGG + Intronic
1132281272 15:100617986-100618008 CACTGCAGCCTGGGTGACACAGG - Intronic
1132590993 16:726415-726437 AGCAGCAGCCATGGGGAAGCCGG - Exonic
1134854629 16:17507964-17507986 CACTGCAGCCTTGGGCTCCCGGG - Intergenic
1135588651 16:23690134-23690156 CACTGCAGACATGGCACCGCGGG - Exonic
1135710459 16:24712185-24712207 CACTCCAGCCTTGGAGACACAGG - Intergenic
1138021502 16:53486223-53486245 CACTGCAGCCTTGACCACGCAGG - Intronic
1138521788 16:57575364-57575386 CGCTGCAGCCAAGGAGACCCTGG + Intronic
1139859597 16:70010276-70010298 CACTCCAGCCTTGGGGACAGAGG - Intergenic
1141231097 16:82168502-82168524 CACTCCAGCCTTGGTGACACAGG - Intronic
1141493369 16:84390039-84390061 CACGGCAGCCCTGTGGACCCCGG + Intronic
1141608437 16:85168756-85168778 CACTGCAGCCCTGGGGTGGGGGG + Intergenic
1143213052 17:5203604-5203626 CAGCACAGCCATGGGGACGGGGG + Intergenic
1143479337 17:7219654-7219676 CACTGCAGCCAGAGGGATGGAGG - Exonic
1143736080 17:8912916-8912938 CAGTGCAGCAGTGGGCACGCAGG + Intronic
1144774356 17:17777591-17777613 GACTGCAGTCATGGGGATGGGGG + Intronic
1145996827 17:29109765-29109787 CACTGCAGCCCACGGGTCGCAGG + Intronic
1147976609 17:44251536-44251558 CAGTACAGCCAGGGGGATGCGGG + Exonic
1150267091 17:63838669-63838691 GGCAGCAGCCATGGGGAGGCGGG - Intronic
1151642380 17:75405546-75405568 CAGAGCAGCCTTGGGGTCGCCGG - Intronic
1151680780 17:75621589-75621611 CACTGCAGACATGGGGACCCAGG - Intergenic
1151886412 17:76925546-76925568 CACTGCAGCCAGTGGGATGTGGG + Intronic
1151962418 17:77413649-77413671 GACTGCAGCCTTGGGGAGGGGGG - Intronic
1152210111 17:78998648-78998670 CAGTGCAGCCATGGGGCACCAGG + Intronic
1152284209 17:79403097-79403119 GACTGCAGCCAGGGGGAAGGAGG + Intronic
1152537286 17:80958112-80958134 CACTCCAGCCTGGGTGACGCAGG - Intronic
1152565446 17:81098213-81098235 CCCTGCACCCATGGGCAGGCTGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155899676 18:31373411-31373433 CACTGTAGTCATCGGGAGGCAGG + Intergenic
1156440830 18:37186133-37186155 CACTCCAGCCTGGGGGACACAGG - Intronic
1156835056 18:41542687-41542709 CACTGCAGCCATGGCCTCTCAGG - Intergenic
1158384835 18:56977433-56977455 CAATGAAGCCATGGGGAAGCGGG - Intronic
1160222296 18:76986022-76986044 CACTGCAAACATGGGGAGGAAGG + Intronic
1160719856 19:592327-592349 CTCTGCAGCCAGGGGGTCGCTGG - Intronic
1160792561 19:929406-929428 CACTGCAGCGTGGGGGCCGCGGG - Exonic
1160970495 19:1765795-1765817 CACTGCAGCCATGGGGACGCGGG - Intronic
1161408061 19:4101489-4101511 CACTGCGGCCATGGGAACCGGGG - Intronic
1161468324 19:4444280-4444302 CACTGCTGACTTGGGGATGCAGG - Intronic
1161616644 19:5274522-5274544 CACGGCACCCATGGGCACCCAGG + Intronic
1162038658 19:7956138-7956160 CACAGCAGCCCTGTGGACGAGGG - Intergenic
1162657172 19:12140022-12140044 CCCTGCGGCCGAGGGGACGCAGG + Intronic
1162831410 19:13286790-13286812 CACGGCAGCCTTGGCCACGCCGG - Exonic
1163914010 19:20223113-20223135 CACTGCAACCACTGGGACCCAGG - Intergenic
1164849745 19:31471779-31471801 CCCTGCAGCCAGGAGGACACGGG + Intergenic
1166655936 19:44611887-44611909 CCCTGGAGCCATGAGGAGGCTGG + Intergenic
1166884110 19:45948564-45948586 CACTCCAGCCTGGGGGACGGAGG + Intronic
1168452415 19:56476915-56476937 CAATGGAGCCATTGGGAAGCCGG - Intronic
926697771 2:15782627-15782649 CACTGCTGCCAAGGGGAAGTGGG + Intergenic
930026747 2:47033802-47033824 CACTGCCGCCCTGGGGACCCAGG - Intronic
931695666 2:64868807-64868829 CACTGCAGCCCTGGGGAGCCAGG + Intergenic
932063583 2:68529965-68529987 CACAGCAGCCATGGAGAAGGCGG - Intronic
932318239 2:70800802-70800824 CACTTCTGCCATGGGGTCACTGG - Intergenic
932345927 2:70995019-70995041 CGCTGCAGCCAGAGGGAGGCGGG + Exonic
933801251 2:85961791-85961813 CACTGCACCCTTGGGGGCCCAGG - Intergenic
934070172 2:88376709-88376731 CTCTGCAGCCATGGGCACCAGGG - Intergenic
936174224 2:110204962-110204984 CACCGCAGCCAGGGAGATGCTGG - Exonic
936433374 2:112482756-112482778 CCCTGCAGCCCGGGAGACGCTGG + Intronic
946357411 2:219196828-219196850 CACTCCAGCCAGGGCGACGGAGG - Intronic
948738933 2:240030356-240030378 TACTGCAGCCCTGGGGCCGTGGG + Exonic
948741007 2:240045999-240046021 TACTGCAGCCCTGGGGCCGTGGG + Exonic
1169431294 20:5538671-5538693 CACTGCAGCCTTGGTGCCGGGGG - Intergenic
1170617791 20:17968414-17968436 AACCGCGGCCATGGCGACGCGGG + Exonic
1170893302 20:20393839-20393861 GACAGCAGCCCTGGGGAAGCGGG - Intronic
1171191809 20:23164304-23164326 CAGTGCAGCCATAGGCAGGCTGG + Intergenic
1171886106 20:30653473-30653495 CACAGAGGCCATGGGGACTCAGG + Intergenic
1172116995 20:32578951-32578973 GGCTGCAGTCATGGGGACGGGGG + Intronic
1172609535 20:36239858-36239880 CACGGCAGCCATGGGGCCAGTGG - Exonic
1174418047 20:50380456-50380478 CAGTGCAGGGATGGGGACGTGGG + Intergenic
1175913912 20:62416871-62416893 GCCTGCAGGGATGGGGACGCAGG + Exonic
1176269234 20:64227059-64227081 CACTGCAGCCAAGGACACGAAGG - Intronic
1176272215 20:64241278-64241300 CTCTGCATCCATGGTGACGGAGG + Exonic
1176624078 21:9076094-9076116 GACTGCAGGCCTGGGGACTCAGG + Intergenic
1178845808 21:36173084-36173106 CACTCCAGCCTTGGGGACAGAGG + Intronic
1179563920 21:42234720-42234742 CTCTGCAGGCCTGTGGACGCAGG + Intronic
1179949961 21:44703894-44703916 CACTGCAGCTGGGGGGACTCAGG - Intronic
1180247961 21:46561040-46561062 AACTGCAGCCCTGGGGACACGGG - Intronic
1180842703 22:18966667-18966689 CTCTGCAGCCCTGGGGATGGGGG + Intergenic
1181272735 22:21669193-21669215 CACTCCAGCCTGGGGGACGGGGG - Intronic
1181289339 22:21778799-21778821 CACTGTGGCCAAGGGGACTCAGG - Intronic
1183318615 22:37150163-37150185 CACAGGAGCCAAGGGAACGCAGG + Intronic
1183951862 22:41356930-41356952 GACTGCAGCCATGGGGGTGGTGG + Intronic
1184279703 22:43429957-43429979 CACTGCGTCCAAGGGGACCCTGG - Intronic
1184402958 22:44284562-44284584 AGCTGCAGCCATGGGCACACAGG - Intronic
950170274 3:10834301-10834323 CTCTGCAGCCCTGTGGACTCAGG + Intronic
950251232 3:11467408-11467430 CACTGCAGCCTGGGCGACACAGG - Intronic
950667744 3:14507443-14507465 CACTGCAGCCCTGTGGAGGCGGG - Intronic
950834131 3:15903131-15903153 GACTTGATCCATGGGGACGCTGG + Intergenic
950893280 3:16424100-16424122 CAGTGTAGCCATGGGGACTGGGG + Intronic
950923489 3:16717521-16717543 CACTGCTTCCCTGGGGAGGCGGG + Intergenic
951619142 3:24581875-24581897 CACTCCAGCCTTGGTGACACAGG - Intergenic
951793646 3:26514826-26514848 CACTGCAACCACTGGGACCCAGG + Intergenic
957792587 3:84959474-84959496 CACCGCAGCGGTGGGGACGGTGG + Intronic
960823062 3:121754797-121754819 CACTCCAGCCTGGGGGACACAGG + Intergenic
960854918 3:122092820-122092842 CACAGCAGACATGGGGACAGTGG - Intronic
961554730 3:127690196-127690218 CAGGGCAGCCATGGGAACTCAGG - Exonic
965373334 3:167891520-167891542 AACTGGAGACATGGGGACGGAGG + Intergenic
966715039 3:183006215-183006237 CACTCCAGCCTGGGGGACGGAGG + Intergenic
968931424 4:3581546-3581568 CACAGGGGCCATGGGGCCGCAGG - Intronic
969340001 4:6534745-6534767 CAGGGCAGCCATGCGGAGGCGGG - Intronic
969625866 4:8305359-8305381 CACTGCAGCCAGGGAGGTGCAGG + Intronic
984466940 4:180111478-180111500 CACAGAAGCCATGGGAACGGGGG - Intergenic
984749365 4:183256913-183256935 CACTGCAGCCCTGTGGGGGCAGG - Intronic
985512067 5:318637-318659 CACAGCAGTCATGGGGAACCCGG + Intronic
985670393 5:1203772-1203794 CACTGCAGCCAGAGGGACTCGGG + Intronic
985674697 5:1224919-1224941 CACTGCTGCCCTCGGGCCGCTGG - Exonic
985814527 5:2116739-2116761 CACTGCAGCCATGGGTGGGACGG + Intergenic
986214655 5:5708121-5708143 CACTGCAGGCTTGGAGACGAAGG - Intergenic
987470499 5:18321823-18321845 AAATGCAGGCATGGGGAGGCAGG - Intergenic
987822585 5:22984794-22984816 CACTCCAGCCTGGGCGACGCAGG + Intergenic
987852704 5:23377533-23377555 CACTCCAGCCTGGGGGACGGAGG + Intergenic
988816407 5:34839098-34839120 GCCTGTAGCCATGGCGACGCGGG - Intronic
991129755 5:63108881-63108903 TACTGCTGCCTTGGGGACACTGG - Intergenic
995180179 5:109223706-109223728 CACTGCAGCCCTGCTGACACCGG - Intergenic
996379771 5:122851196-122851218 CACTCCAGCCTGGGTGACGCAGG - Intronic
997469315 5:134108100-134108122 CTCTGCAGACCTGGGGAGGCGGG + Intergenic
999736075 5:154514330-154514352 CTCTTCAGCCAGAGGGACGCAGG + Intergenic
999994289 5:157077429-157077451 CACTCCAGCCTTGGTGACACAGG - Intergenic
1001972569 5:175968175-175968197 CGCTGCAGCCATGGGGCCCTCGG - Exonic
1002244872 5:177875606-177875628 CGCTGCAGCCATGGGGCCCTCGG + Intergenic
1003518012 6:6833859-6833881 TCCTGCGGCCTTGGGGACGCTGG - Intergenic
1006680738 6:35795397-35795419 CACGGCACCCCTGGGGAGGCAGG - Intronic
1007605356 6:43114029-43114051 CCCAGCAGCCCTGGGGCCGCAGG - Intronic
1009398873 6:63230838-63230860 CACGGCAGCCATGGAGAAGGCGG - Intergenic
1010020464 6:71154046-71154068 CAATTCTGCCATGGGGACTCTGG + Intergenic
1014173742 6:118308522-118308544 CAATGCAACCATGGGTAAGCAGG - Intronic
1015640248 6:135324292-135324314 CACTTCAGCCTGGGTGACGCAGG + Intronic
1017531418 6:155296133-155296155 CACTTCTGCCATGGGAATGCAGG + Intronic
1018868192 6:167761337-167761359 CAAGGCAGCCATGTGGATGCCGG - Intergenic
1018907495 6:168083987-168084009 CACTGCAGGCCTGGGGACAGAGG + Intergenic
1018978725 6:168585031-168585053 CACTGCAGCCTTGGTTACCCAGG + Intronic
1019699007 7:2463794-2463816 CACTCCAGCCTGGGGGACACAGG + Intergenic
1022428000 7:30285709-30285731 CACAGCAGCCCTGAGGACGGCGG + Exonic
1023205126 7:37740798-37740820 CAGTGCTGGCATGTGGACGCTGG + Exonic
1023515119 7:40994144-40994166 CATTGCATCCTTGGGGACACAGG - Intergenic
1024316226 7:48019813-48019835 CAGTGAAGCCATGGGGTCCCGGG - Intronic
1024852010 7:53729797-53729819 CACTCCAGCCTGGGGGACACAGG - Intergenic
1025701456 7:63824027-63824049 CACTCCAGCCCTGGTGACACAGG + Intergenic
1025813357 7:64889186-64889208 CCCTGCAGTCATGGGGTCACCGG + Intronic
1027374642 7:77537521-77537543 GACCGCAGCCGGGGGGACGCGGG + Exonic
1028641775 7:93050244-93050266 CACTGCAGCCTGGGCGACACAGG + Intergenic
1030831061 7:114222187-114222209 CACTCCAGCCTTGGTGACACAGG - Intronic
1033597679 7:142868519-142868541 GCCTGCAGCCACGGGGACGGAGG + Exonic
1035120271 7:156560936-156560958 CACCGGAGCCATGGGGAGGAGGG + Intergenic
1035642591 8:1195092-1195114 TGCTGCAGCCATGAGGATGCCGG - Intergenic
1038373260 8:27012873-27012895 CACGGCAGCCATGGAGAAGGCGG - Intergenic
1043465589 8:80503549-80503571 CACTCCAGCCTTGGTGACACAGG - Intronic
1044634046 8:94304766-94304788 CACTTCACCCCTGGGGACCCTGG + Intergenic
1044851088 8:96428745-96428767 CAGTGAAGCCATGGGGTCTCAGG + Intergenic
1049390254 8:142364103-142364125 CACTGCAGCCATGGGGCGCCAGG - Intronic
1049437148 8:142591951-142591973 CACTTTAGCCCTGGGGACTCTGG - Intergenic
1049690434 8:143956490-143956512 CACTGCAGCCTTGGGTGGGCTGG - Intronic
1049763576 8:144342447-144342469 CTATGCAGCCAGGGGGACACAGG - Intergenic
1049795200 8:144493926-144493948 CTCTGCAGCCAGGGGGACTGGGG + Intronic
1051249191 9:15142160-15142182 CACTGGAGACATGGGTAGGCAGG - Intergenic
1052413079 9:28147462-28147484 CACGGCAGCCATGGAGAAGGCGG + Intronic
1052766324 9:32644831-32644853 GACTGCATCCATGGGAACACAGG - Intergenic
1053055243 9:34989930-34989952 CTCTGCTGCCTTGGGGATGCGGG + Intronic
1054458705 9:65450383-65450405 CACAGGGGCCATGGGGCCGCAGG + Intergenic
1056020530 9:82433632-82433654 CACAGCAGCCATGGAGAAGGTGG - Intergenic
1057071367 9:92103683-92103705 CACGGCAGCCATGGAGAAGGCGG + Intronic
1057180874 9:93029492-93029514 GCCTGCAGCCCTGGGGACGGGGG - Intronic
1057236535 9:93366072-93366094 GCCGGCAGCCATGGGGAGGCTGG + Intergenic
1059481085 9:114590163-114590185 CACTCCAGCCTTGGGGACAGAGG + Intronic
1059938930 9:119338849-119338871 CACTCCAGCCCTGGCGACACAGG + Intronic
1060410436 9:123396366-123396388 CACTGCTGCCCTGGGGGCGTGGG - Intronic
1062012797 9:134275930-134275952 CTCTTTAGCCCTGGGGACGCGGG - Intergenic
1062288397 9:135783949-135783971 CACGGCAGCCACGGGGTCGAGGG - Intronic
1062429518 9:136520835-136520857 CAGGGCAGCCCTGGGGTCGCAGG - Intronic
1203747260 Un_GL000218v1:46522-46544 GACTGCAGGCCTGGGGACTCAGG + Intergenic
1203562841 Un_KI270744v1:72958-72980 GACTGCAGGCCTGGGGACTCAGG - Intergenic
1185554241 X:1007908-1007930 CACTCCAGCCTGGGGGACGGAGG - Intergenic
1186809078 X:13169252-13169274 CCCTTCAGCCATGGTGACCCAGG + Intergenic
1189407134 X:40735401-40735423 CACTGGGGCCATGGCGGCGCAGG + Exonic
1189558181 X:42166379-42166401 CAATGCAGCCTTGGGCACCCTGG - Intergenic
1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG + Intronic
1190978934 X:55437688-55437710 CAATGAAGCCATGGGGTCACTGG - Intergenic
1191755094 X:64584183-64584205 CACTGCAGCCTTGTGGGCTCAGG + Intergenic
1192010429 X:67264827-67264849 CAGTGAAGCCATTGGGTCGCAGG + Intergenic
1192108963 X:68344576-68344598 CACTCCAGCCTGGGGGACACTGG + Intronic
1192522462 X:71814665-71814687 CACCCCAGCCATGGAGAGGCCGG + Intergenic
1194841358 X:98747704-98747726 CAGTGCAGCCATTGGGTCCCTGG + Intergenic
1197256861 X:124272887-124272909 CACTGGGGCCATGGGGAAGGTGG + Intronic
1199621665 X:149706765-149706787 CACTGCAGCCAAGGTGATGGGGG + Intronic
1200057407 X:153468901-153468923 CACTGCAGCAAAGGGGTGGCTGG + Intronic
1200072948 X:153537987-153538009 CACTGTGGCCTTGGGGACCCAGG - Intronic
1200157907 X:153987350-153987372 CACTCCAGCCTGGGGGACACAGG - Intergenic