ID: 1160972459

View in Genome Browser
Species Human (GRCh38)
Location 19:1775634-1775656
Sequence GAGTGGGCATGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2194
Summary {0: 2, 1: 0, 2: 14, 3: 203, 4: 1975}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160972459_1160972474 17 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972474 19:1775674-1775696 GCCCTCCACCCCCCCCCGGAGGG 0: 1
1: 0
2: 2
3: 32
4: 317
1160972459_1160972478 21 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972478 19:1775678-1775700 TCCACCCCCCCCCGGAGGGGAGG 0: 1
1: 0
2: 2
3: 18
4: 179
1160972459_1160972472 13 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972472 19:1775670-1775692 GGAAGCCCTCCACCCCCCCCCGG 0: 1
1: 0
2: 4
3: 34
4: 308
1160972459_1160972473 16 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972473 19:1775673-1775695 AGCCCTCCACCCCCCCCCGGAGG 0: 1
1: 0
2: 2
3: 29
4: 289
1160972459_1160972480 22 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972480 19:1775679-1775701 CCACCCCCCCCCGGAGGGGAGGG 0: 1
1: 0
2: 7
3: 30
4: 612
1160972459_1160972465 -8 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972465 19:1775649-1775671 GCCCACTCCCTCCAGGCCAAAGG 0: 1
1: 0
2: 2
3: 26
4: 274
1160972459_1160972476 18 Left 1160972459 19:1775634-1775656 CCTTCCTCCCTCCATGCCCACTC 0: 2
1: 0
2: 14
3: 203
4: 1975
Right 1160972476 19:1775675-1775697 CCCTCCACCCCCCCCCGGAGGGG 0: 1
1: 0
2: 1
3: 60
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160972459 Original CRISPR GAGTGGGCATGGAGGGAGGA AGG (reversed) Exonic
Too many off-targets to display for this crispr