ID: 1160973236

View in Genome Browser
Species Human (GRCh38)
Location 19:1779703-1779725
Sequence CCAGACACACAGATGCGACA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160973236_1160973239 1 Left 1160973236 19:1779703-1779725 CCGTGTCGCATCTGTGTGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 161
Right 1160973239 19:1779727-1779749 GCCTGATCGGTGCTGTTCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160973236 Original CRISPR CCAGACACACAGATGCGACA CGG (reversed) Exonic
901369966 1:8788743-8788765 TCAGGCACATAGATGCTACATGG - Intronic
903740840 1:25557495-25557517 CCAGACACACACTGGGGACATGG - Intronic
904345721 1:29867593-29867615 TCTGAGACACAGATGGGACAAGG + Intergenic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
906868751 1:49452430-49452452 CCAGAAACACAGATTCGACAAGG - Intronic
907311087 1:53539518-53539540 CCACACACACACATACCACACGG + Intronic
908587010 1:65580864-65580886 CCAGAGGCACAGATACCACATGG + Intronic
908835073 1:68221436-68221458 CCAGACACACAGGAGCTAAAAGG + Intronic
915238319 1:154501987-154502009 CCAGACACGCAGAGGCGCCAGGG + Exonic
915324213 1:155072361-155072383 CCAGAAACAGACAGGCGACAGGG - Intergenic
915748688 1:158184155-158184177 CCAGAGACACAGATGTGGCAAGG - Exonic
919771062 1:201158868-201158890 CCAGACCCACAGCTGTGGCACGG - Intronic
920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG + Intergenic
920944113 1:210512210-210512232 GCAGACCCAGAGATGGGACAGGG + Intronic
921099977 1:211920357-211920379 CCAGACACAGAATTGCGACTGGG - Intergenic
922481414 1:225941980-225942002 CCAGACACAGACAAGGGACAGGG + Intergenic
923284550 1:232480128-232480150 ACACACACACAGATGCGGCCAGG - Intronic
923473702 1:234313825-234313847 CCAGAAACTCAGATGTGTCAGGG + Intronic
1064261579 10:13790622-13790644 CCAGAGCCACAGAAGCCACATGG + Intronic
1065782108 10:29179282-29179304 CCAGATTCACAGAAGCGAGAAGG + Intergenic
1067356739 10:45535464-45535486 ACAGAAACACAGATGCAAGAGGG + Intronic
1069694389 10:70376134-70376156 CCTGGCACACAGATGCTACTTGG + Intronic
1070488702 10:76955579-76955601 CCAGACACTGAGATGCTACTCGG - Intronic
1071370361 10:84945055-84945077 TCATACATACAGATGAGACAAGG + Intergenic
1072368787 10:94743323-94743345 CCAGACACACAGATTCTCCAAGG - Intronic
1072944378 10:99796734-99796756 CCAAAAACAAAGATGCCACAGGG + Intronic
1073943105 10:108720011-108720033 CCAGAGACACAGGTGTGATAGGG + Intergenic
1075915473 10:126162595-126162617 ACAGCCACACAGATGAGACTTGG + Intronic
1076944988 10:133640591-133640613 CCAGGCACGCAGATCCGGCAGGG + Intergenic
1077304986 11:1864949-1864971 CCAGACAGAGAGAAGGGACAGGG + Intronic
1077549469 11:3193643-3193665 CCCGACACTCAGAGGGGACAGGG + Intergenic
1078895474 11:15593575-15593597 CCATACTCACACATGCCACATGG + Intergenic
1084629310 11:70335879-70335901 CCATACACACAAATGGGGCATGG - Intronic
1087215323 11:95487211-95487233 CCAGACACCCAGATGGAAGAAGG - Intergenic
1090628776 11:128628078-128628100 CTTGACGCACAGATGGGACATGG - Intergenic
1092714030 12:11369671-11369693 CCACACACACTGATTAGACAGGG + Intronic
1096176982 12:49528271-49528293 CCACCCAGACAGATGGGACAAGG + Intergenic
1096412709 12:51388783-51388805 CAAGGCAGAGAGATGCGACAGGG - Intronic
1098128092 12:67320856-67320878 ACACACACACACATGAGACAGGG + Intergenic
1098350643 12:69555649-69555671 TCATACACACAGATTCCACAGGG + Intronic
1099457166 12:82877991-82878013 ACAGACACACAGATGAGATTGGG + Intronic
1101579267 12:106027221-106027243 CTTGACACACAGATGAGCCAAGG - Intergenic
1101841885 12:108333467-108333489 CCAGACACCCAGATGTGCAAAGG + Intronic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1107947994 13:45437006-45437028 CCAGTCACACAGATAGGCCAAGG + Intergenic
1108954688 13:56138516-56138538 CCAGTCACACCGATGCAAGAGGG - Intergenic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1111770577 13:92590931-92590953 ACAGACACACAGAAAGGACAGGG - Intronic
1112813498 13:103246668-103246690 ACAGACACACAGCAGCAACAGGG + Intergenic
1112834673 13:103499830-103499852 AAAGACACACAGGTGAGACAAGG + Intergenic
1113578797 13:111413869-111413891 CCACACACCCAGATGCCACCTGG - Intergenic
1113777081 13:112953922-112953944 CTAGACACTCATATGCGACCTGG - Intronic
1118615571 14:67572440-67572462 TCAGACACACAGACCCCACAAGG + Intronic
1119905691 14:78299658-78299680 GCAGACACACTGATGCAGCATGG + Intronic
1122409645 14:101519261-101519283 CCAGACACTCAGATGCCATGGGG - Intergenic
1202918346 14_KI270723v1_random:5913-5935 CCAGGCACGCAGATCCGGCAGGG + Intergenic
1202926283 14_KI270724v1_random:28664-28686 CCAGGCACGCAGATCCGGCAGGG - Intergenic
1128611997 15:69081531-69081553 CCAGCCACACAGATGCAGCCTGG - Intergenic
1128694161 15:69747834-69747856 TCACACACACAAATGCCACAGGG - Intergenic
1129978075 15:79839557-79839579 CCTGACAAAAAGATGCGTCAGGG - Intronic
1130302368 15:82689520-82689542 CCAGGCACAAAGAAGGGACATGG + Intronic
1131648110 15:94367724-94367746 GCAGACACACAGATCAGAGACGG - Exonic
1132798153 16:1735871-1735893 ACAGTCACACAGATGCTCCATGG - Intronic
1133077091 16:3288480-3288502 CCAGGCACCCAGGTGGGACAAGG + Exonic
1133191879 16:4139887-4139909 ACAGACACACAGAAGCAAAAGGG - Intergenic
1139952550 16:70679254-70679276 GGAGACAGACAAATGCGACAAGG + Intronic
1140288658 16:73629146-73629168 GCACACACACAGATGACACACGG - Intergenic
1143121078 17:4607294-4607316 CCAGCCCCACAGCCGCGACAGGG - Intronic
1144493636 17:15734124-15734146 CCAGAGACCCAGATGTGACCCGG + Intronic
1144710245 17:17396789-17396811 CAAGACCCACAGAAGCTACAAGG + Intergenic
1144906629 17:18642528-18642550 CCAGAGACCCAGATGTGACCCGG - Intronic
1145714836 17:27009524-27009546 CCAGACACACAGACGCAGCCTGG - Intergenic
1148465782 17:47864562-47864584 CCAGACTCAAAGATTCGGCAGGG - Intergenic
1148864607 17:50622071-50622093 CCAGACACCCAGGAGTGACACGG + Intronic
1149567809 17:57652226-57652248 GCAGCCACACAGATCCGACAGGG - Intronic
1154042030 18:10865526-10865548 CCAGAAACACTGATGTGACATGG - Intronic
1159527951 18:69618012-69618034 ACAGAAACACAGAGGAGACATGG + Intronic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160973236 19:1779703-1779725 CCAGACACACAGATGCGACACGG - Exonic
1162427295 19:10603989-10604011 CCAGGCCCACACATGAGACAGGG + Intronic
1164605073 19:29592026-29592048 CCAGAGAGACAGAGGTGACAAGG + Intergenic
1164973238 19:32550253-32550275 CCAGAAACACAGGTGCGGCTGGG - Intergenic
1166214344 19:41325717-41325739 CAAGACACACAGCAGCGAGAGGG - Intronic
1167055350 19:47107541-47107563 CTATTCACACAGATGCGAAATGG + Intronic
1167299668 19:48671531-48671553 CCAGGCACCCAGAGGCCACAGGG + Intronic
925278050 2:2664243-2664265 TCAGACACACAGAGAGGACATGG + Intergenic
929454745 2:42057812-42057834 CCAGACAGACAGATGTGACCAGG + Exonic
929667589 2:43845251-43845273 CCAGGGACCCAGATGGGACATGG + Intronic
930331154 2:49986132-49986154 CCAGAAACTCAGATGCCACAGGG + Intronic
931457904 2:62426541-62426563 CCACACACACAGCTGGGAGAAGG + Intergenic
935120677 2:100180869-100180891 CCAGACACACACATACTCCAAGG + Intergenic
936132461 2:109858300-109858322 AGAGAAACACAGATGCCACAAGG + Intergenic
936212236 2:110513185-110513207 AGAGAAACACAGATGCCACAAGG - Intergenic
936421376 2:112367752-112367774 AGAGAAACACAGATGCCACAAGG - Intergenic
937265224 2:120611156-120611178 GCAGACACACAGCTGCCACTGGG - Intergenic
937499059 2:122458146-122458168 ACAGAAAAACAGATGCCACATGG + Intergenic
938700912 2:133878446-133878468 ACAGACAGACACATGTGACAGGG + Intergenic
938754950 2:134371102-134371124 CCAGAGACACTGATTGGACATGG + Intronic
942990993 2:182202530-182202552 CCAGTCACACAGCTGGTACATGG + Intronic
946360165 2:219214606-219214628 CCGGACACCCAGATTCCACAGGG + Intronic
948703372 2:239774648-239774670 ACACAGACACAGATGTGACATGG - Intronic
1170759625 20:19238240-19238262 ACAGACACACAGATGACAAACGG - Intronic
1172779937 20:37430539-37430561 TCAGACACACAGCAGGGACATGG - Intergenic
1172830907 20:37833557-37833579 ACACACACACAGAAGCAACAAGG - Intronic
1173631847 20:44522071-44522093 ACAGACGCACGGATGCGTCACGG + Exonic
1174435340 20:50502518-50502540 ACAGTCACACAGATGAGAAATGG - Intergenic
1175052064 20:56165000-56165022 AAAGACACACAGCTGCTACATGG - Intergenic
1175517959 20:59580860-59580882 CTAGACACACAGAAGCAAAAGGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177294504 21:19157244-19157266 CCAGACACACAGAGGAGAGCTGG - Intergenic
1182452864 22:30431544-30431566 ACAAACACACAGATGCTAAATGG - Intergenic
1185043663 22:48518206-48518228 CCAGACACCCAGATCCCACGTGG - Intronic
949986456 3:9545052-9545074 CCTGACACACACACACGACACGG + Intronic
950967085 3:17154091-17154113 CCAAAGACCCAGATGTGACAGGG + Intergenic
954290551 3:49647747-49647769 CCAGGCACAGAGATTCTACATGG + Intronic
954924152 3:54217575-54217597 GCAGACACACAGAGACGAAAGGG + Intronic
956816314 3:72911516-72911538 CCAGACCCACTGATCCGAGATGG - Intronic
960058688 3:113296626-113296648 CCAGCTACACAGATGCTTCATGG + Intronic
961581494 3:127887119-127887141 ACAGACAAACAGATGCCACCTGG + Intergenic
964758133 3:160107278-160107300 CCAGTCACACAGGGGCTACATGG + Intergenic
965169449 3:165242942-165242964 CCAGACAAACAGCTGAGAAATGG - Intergenic
968904286 4:3444431-3444453 CCCGACATACAGGTGCGCCACGG + Exonic
969217745 4:5735538-5735560 CCAGCCACACAGCTGTGATATGG - Intronic
971473475 4:27051001-27051023 AGAGACACACAGATTCGACATGG - Intergenic
972336046 4:38107871-38107893 CAAGAAACACAGAAGCAACATGG - Intronic
977254114 4:94721593-94721615 CCAGATACACAGATGCAAGCTGG + Intergenic
982068635 4:151675706-151675728 CAAGACAAACAGATGTAACAAGG + Intronic
985448370 4:190041100-190041122 CCAGGCACGCAGATCCGGCAGGG + Intergenic
988699859 5:33662666-33662688 CCAGCCAGGCAGATGCCACAGGG - Intronic
988707948 5:33743856-33743878 CCAGAGACAAAGATGTGGCAAGG - Intronic
989780900 5:45263452-45263474 GCAAGCACACAGATGAGACAGGG - Intronic
993182771 5:84575876-84575898 ACAGAAACACAGATACCACATGG - Intergenic
997254991 5:132421678-132421700 CCAGGCACACAGGTGTGAGAAGG + Intronic
1000166552 5:158654866-158654888 CCAGACACACAGCTAACACATGG - Intergenic
1000743726 5:165003433-165003455 CCAGCCTCACAGATGAGAGAGGG - Intergenic
1001243808 5:170090629-170090651 CAAGACACATACATGCTACAAGG - Intergenic
1001954993 5:175842937-175842959 CTAGACTCACAGTTGCGCCAGGG - Intronic
1002074314 5:176699073-176699095 CCAGATGCACAGAGGCCACAAGG - Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1010306412 6:74328305-74328327 GCAGACACACAGATACTAAATGG + Intergenic
1019636652 7:2079567-2079589 CCAGATAAACAGAGGCCACACGG + Intronic
1019717201 7:2544821-2544843 CCAGACACTCAGATTCAGCAAGG + Intronic
1020669399 7:11087723-11087745 CCACACACACAGATGAAGCATGG - Intronic
1027471438 7:78579023-78579045 TGAGCCACACAGATGAGACATGG - Intronic
1027726451 7:81811726-81811748 CCACACACACATATAGGACATGG + Intergenic
1029933094 7:104394288-104394310 CCAGAGGCACAGATGCAACCTGG - Intronic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1035239077 7:157518192-157518214 TCAGACCCAGAGATGCCACATGG - Intergenic
1039645233 8:39275093-39275115 CTAGACACAGAGATGCATCAGGG - Intronic
1043246209 8:78005500-78005522 CGAGACACAGAGATGCTACAGGG - Intergenic
1048377684 8:133836925-133836947 CCAGGCACACAGAAGAGAAAGGG - Intergenic
1048856788 8:138693225-138693247 CCAAACACACAGATGCAGCCAGG - Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1052116107 9:24649825-24649847 CCAGGCACACAGCTGTGGCAGGG - Intergenic
1052764841 9:32630460-32630482 CCAGAAAAACAGATGTGCCAGGG - Exonic
1053681360 9:40487617-40487639 CCAGCCATACACATGAGACACGG - Intergenic
1054282353 9:63137317-63137339 CCAGCCATACACATGAGACACGG + Intergenic
1054294449 9:63323133-63323155 CCAGCCATACACATGAGACACGG - Intergenic
1054392470 9:64627621-64627643 CCAGCCATACACATGAGACACGG - Intergenic
1054427118 9:65132830-65132852 CCAGCCATACACATGAGACACGG - Intergenic
1054503257 9:65888709-65888731 CCAGCCATACACATGAGACACGG + Intronic
1056378494 9:86036437-86036459 CCACACACAGAGGTGCCACAAGG - Exonic
1059427384 9:114229651-114229673 CCAGACACTCAGATCAGTCATGG + Intronic
1060679452 9:125548350-125548372 CCAGCCACACAGAGGTGAGAGGG + Intronic
1062044312 9:134418044-134418066 CCAGAAGCAAAGATGCCACAGGG - Intronic
1185521655 X:744707-744729 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185522645 X:752997-753019 CCAGAGAAACAGATTCAACAGGG - Intergenic
1186086411 X:5995290-5995312 ACAGACAGACAGATGAGTCAGGG + Intronic
1190760493 X:53434140-53434162 ACAGACAGACAGATGCGCCGCGG + Intronic
1196634274 X:117982977-117982999 GCAGACAGACAGATGCGAAGTGG + Intronic
1197790501 X:130249206-130249228 CCATACACACAGTTGCCACCTGG + Intronic
1202067942 Y:20960216-20960238 CCAGAGGCACAGGTGCCACAGGG + Intergenic