ID: 1160973500

View in Genome Browser
Species Human (GRCh38)
Location 19:1780742-1780764
Sequence GGTCTGACAGGGCCACGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160973500_1160973507 -10 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973507 19:1780755-1780777 CTGTCAGACCACGCAGGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 118
1160973500_1160973508 -4 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973508 19:1780761-1780783 GACCACGCAGGGGCTGGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 123
1160973500_1160973515 23 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973515 19:1780788-1780810 ATGAGCTCAGCCGGGGGTGACGG 0: 1
1: 0
2: 0
3: 23
4: 280
1160973500_1160973510 -1 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973510 19:1780764-1780786 CACGCAGGGGCTGGTTTTGGTGG 0: 1
1: 0
2: 1
3: 15
4: 262
1160973500_1160973511 14 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973511 19:1780779-1780801 TTTGGTGGAATGAGCTCAGCCGG 0: 1
1: 0
2: 3
3: 38
4: 233
1160973500_1160973513 16 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973513 19:1780781-1780803 TGGTGGAATGAGCTCAGCCGGGG 0: 1
1: 0
2: 1
3: 6
4: 137
1160973500_1160973514 17 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973514 19:1780782-1780804 GGTGGAATGAGCTCAGCCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 112
1160973500_1160973512 15 Left 1160973500 19:1780742-1780764 CCTCCTCGTGGCCCTGTCAGACC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1160973512 19:1780780-1780802 TTGGTGGAATGAGCTCAGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160973500 Original CRISPR GGTCTGACAGGGCCACGAGG AGG (reversed) Exonic
900815035 1:4837181-4837203 GTTCTGTCAAGGCCAAGAGGAGG - Intergenic
900867800 1:5280851-5280873 GGTGTGACAGGGACAGGTGGAGG - Intergenic
902565656 1:17309740-17309762 GGTCTCCCAGGGCCACATGGTGG + Intronic
902919297 1:19656874-19656896 GGAGTGCCCGGGCCACGAGGAGG + Exonic
904014787 1:27411047-27411069 CATCTGACAGGGCCACCAGCAGG + Intronic
904933990 1:34113550-34113572 GGACTGTAAGGGCCATGAGGGGG - Intronic
914042820 1:144065199-144065221 GCTCTGACAGGGGGAGGAGGGGG - Intergenic
914135266 1:144895289-144895311 GCTCTGACAGGGGGAGGAGGGGG + Intronic
920489684 1:206403445-206403467 GCTCTGACAGGGGGAGGAGGGGG - Intronic
924291231 1:242538466-242538488 TGTCTGGCAGGGCAACAAGGCGG - Intergenic
1067481087 10:46598040-46598062 GGTCAGGCCGGGCCGCGAGGTGG + Intergenic
1067613665 10:47743782-47743804 GGTCAGGCCGGGCCGCGAGGTGG - Intergenic
1067801621 10:49363001-49363023 GGTCTGACAGGGCGCTGGGGTGG + Intergenic
1071629075 10:87203754-87203776 GGTCAGGCCGGGCCGCGAGGTGG - Intergenic
1077048093 11:555060-555082 GCACCGACAGGGCCACCAGGGGG + Exonic
1077074101 11:692269-692291 GGGATGACAGGGGCAGGAGGTGG - Intronic
1083130327 11:60618902-60618924 GCTCGGACAGGGCCACTAGAGGG - Intergenic
1083897051 11:65625221-65625243 GGTAGGACAGTGCCACCAGGAGG - Exonic
1089764515 11:120752967-120752989 GGTGGGACTGGCCCACGAGGAGG - Intronic
1092525625 12:9308155-9308177 AGACTGACCGGGCCACGGGGAGG - Intergenic
1092541664 12:9423669-9423691 AGACTGACCGGGCCACGGGGAGG + Intergenic
1094511378 12:31098838-31098860 AGACTGACCGGGCCACGGGGAGG - Intronic
1102698363 12:114817600-114817622 TGTCTGAGTGGGCCAAGAGGTGG + Intergenic
1102725536 12:115061131-115061153 GACCTGCCAGGGCCACAAGGAGG - Intergenic
1104577766 12:129983517-129983539 GGTCAGACTTGGACACGAGGTGG + Intergenic
1112196553 13:97232188-97232210 GGACAGACAGGGGCACGAGATGG - Intronic
1112370258 13:98787699-98787721 GGTCTGGAAGGGCCAAGAGACGG - Intergenic
1113201260 13:107868543-107868565 GGTCTGGCAGGGGCAAGGGGCGG - Intergenic
1117834972 14:59794620-59794642 GGTGTGACAGGGCAACAAGATGG - Intronic
1119842067 14:77800531-77800553 GAACTCACAGGGCCACCAGGGGG - Intronic
1121277740 14:92679276-92679298 GGTCAGACAGGGCTGCCAGGAGG - Intronic
1121278111 14:92681244-92681266 TGCCTGCCAGGGCCACTAGGTGG - Intronic
1122156683 14:99754299-99754321 GGTCGGCCAGGGCAAGGAGGGGG + Intronic
1122937434 14:104966644-104966666 GCCCTGGCAGGGCCACGTGGAGG - Intronic
1124899650 15:33810377-33810399 ATACTGACAGGGCCACAAGGAGG + Intronic
1125211808 15:37225604-37225626 AGTCTGAGAAGGCCACCAGGAGG + Intergenic
1125768445 15:42150129-42150151 TGTCTTTCAGGGCCAGGAGGTGG - Exonic
1127466641 15:59250479-59250501 GGTCTGGGAGGGTCCCGAGGTGG - Intronic
1130649138 15:85752095-85752117 GGGCTGAGGGGGCCACGCGGAGG + Intergenic
1131540332 15:93270139-93270161 GGTCTGGCAGGGAGATGAGGAGG + Intergenic
1134018791 16:10907448-10907470 GCTCTGCCAGGGCCCCGGGGGGG - Exonic
1134834049 16:17346600-17346622 GGTCAGAGATGGCCACGAGGAGG + Intronic
1136536585 16:30903157-30903179 GCTCACACAGGGCCACGAGAAGG - Exonic
1139940476 16:70601807-70601829 GCTCTGCCAGGGCCATGAGAAGG - Intronic
1140541284 16:75758601-75758623 GGTCTGACAAGGGGAGGAGGTGG + Intronic
1142383395 16:89746790-89746812 GTTCTGAGAAGGCCACGAGAGGG + Intronic
1142408217 16:89902901-89902923 GCTCTGTCTGGGCCCCGAGGAGG + Intronic
1142688809 17:1592654-1592676 GGTCTGCCAGGGCCCCGTAGGGG - Intronic
1142930973 17:3283926-3283948 GGTCTGACAGGGTCCCCACGAGG + Intergenic
1142944440 17:3412581-3412603 GGTCTGACAGGGTCCCCACGAGG - Intergenic
1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG + Intergenic
1146062889 17:29616238-29616260 GGTTGGGCAGGGCTACGAGGCGG - Intronic
1146482121 17:33213219-33213241 TGGCTGCCAGGGCCAGGAGGTGG + Intronic
1147368389 17:39974515-39974537 GATCTGACGGGGGCAGGAGGTGG + Intronic
1150434667 17:65144507-65144529 GGTCAGACAGGGTCCCGCGGTGG + Intronic
1152722198 17:81928557-81928579 GGTCTGGCAGGGACAGGCGGAGG - Intergenic
1154020485 18:10660373-10660395 GGTCTGCAAGGGCCACGCTGTGG + Intergenic
1157135164 18:45047070-45047092 GGTCTGACTGTGGCATGAGGTGG - Intronic
1157439136 18:47696885-47696907 GGGCAGACAGGGCAAAGAGGAGG - Intergenic
1157564844 18:48672895-48672917 GGACTGACAGGGCCACAGGATGG - Intronic
1157776758 18:50402145-50402167 TGCCTGACAGGGCCTGGAGGCGG + Intergenic
1159975313 18:74704097-74704119 GGTCAGGCATGGCCATGAGGAGG + Intronic
1160056149 18:75482785-75482807 TGTCTCACATGGCCAGGAGGTGG + Intergenic
1160157228 18:76442976-76442998 GGCCGGCCGGGGCCACGAGGTGG - Exonic
1160451989 18:78972698-78972720 GTTCTGCCAAGGTCACGAGGAGG + Intergenic
1160556849 18:79731066-79731088 CGTCTCACAGGCCCACGGGGGGG - Intronic
1160844603 19:1160904-1160926 GCTCTGCCAGGACCACAAGGGGG + Intronic
1160973500 19:1780742-1780764 GGTCTGACAGGGCCACGAGGAGG - Exonic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161266000 19:3365100-3365122 GGTCTGACAGGTAAACTAGGAGG - Intronic
1161960598 19:7520857-7520879 GGGCTGACAGTGCCACGAGTGGG - Exonic
1163762906 19:19146755-19146777 GGCCTGGCTGGGCCCCGAGGGGG - Exonic
1163797583 19:19346285-19346307 AGGATGGCAGGGCCACGAGGAGG - Intronic
1165743639 19:38217722-38217744 GGAGGGAGAGGGCCACGAGGTGG + Intronic
1166076684 19:40417701-40417723 GGACTGACAAGGCCTGGAGGAGG - Intergenic
1166825628 19:45607294-45607316 GGTCTCCCAGGGCCCCGAGCTGG + Intronic
1167605772 19:50480676-50480698 GGGCTGCCGGGGCCATGAGGTGG + Exonic
1168107633 19:54174142-54174164 GGGCTGCCAGGGCCAGGAAGTGG + Exonic
1168294013 19:55370054-55370076 GGCCAGACAGGGCCCCGAGAGGG - Intronic
932404346 2:71503637-71503659 GGTCTGCCAGGGAGACTAGGTGG - Intronic
934563262 2:95323930-95323952 GGGCTGCCAGGGCCACGTGCAGG + Intronic
936471836 2:112805754-112805776 GGTCTGACAGGGCAAGCAGCAGG - Intergenic
939991293 2:148878216-148878238 GGACTGGAAGGGCCACAAGGGGG - Intronic
942182965 2:173397741-173397763 GATCTGACAGTGACACCAGGTGG + Intergenic
945279395 2:208021743-208021765 GGGCTGAAAGGGCCACAACGGGG - Intronic
948756142 2:240160749-240160771 GGTCACACAGGACCATGAGGCGG - Intergenic
1170827701 20:19810442-19810464 GGGCTGCCAGGGCCCCCAGGAGG + Intergenic
1173150892 20:40565791-40565813 GCTCTGACAGCCCCACAAGGTGG - Intergenic
1175363049 20:58429832-58429854 GGTCTCACAGGCCCTCCAGGAGG - Intronic
1179727684 21:43349438-43349460 GGTCACACAGGGCCTCCAGGGGG - Intergenic
1181315842 22:21970516-21970538 GGTCTGGCAGGGGCAGGAGAGGG - Intronic
1182652840 22:31866069-31866091 GCTGTGACAAGCCCACGAGGTGG + Intronic
1183481361 22:38067238-38067260 GATCAGACAGGGTCACAAGGTGG + Intronic
1183828691 22:40406776-40406798 GGTCTGACTGGGCCAGGCTGGGG - Intronic
1184042455 22:41952199-41952221 GCTCTGAGTGGGCCAGGAGGGGG - Intergenic
1184087302 22:42272612-42272634 GGTCTGAAAGGGCGGGGAGGGGG - Intronic
1184108713 22:42383208-42383230 GGTCAGAGAGGCCCAGGAGGTGG + Exonic
1184519004 22:44981343-44981365 GGTCTGAGGGGGTCACGAGAAGG - Intronic
1185345401 22:50308433-50308455 GGTCCTTCAGGGCCAGGAGGTGG + Intergenic
950508955 3:13414272-13414294 GCTCTGTCAGCCCCACGAGGTGG - Intronic
951805412 3:26638469-26638491 GGTCTGACAGGTCCATGATGAGG - Intronic
953413251 3:42701849-42701871 GGGCTGACGGGGCCAAGAGGTGG + Intronic
953860560 3:46540775-46540797 AGTTTGCCAGGGCCACGAGAAGG - Intronic
954263340 3:49455634-49455656 GGTCTGAGAAGGCCACATGGAGG - Intergenic
954832507 3:53434517-53434539 GGTATGACAGGGTCACCAAGGGG - Intergenic
964506340 3:157404241-157404263 GTTATGCCAGGGCCACGAGGAGG + Intronic
967088605 3:186115941-186115963 GGTTTGACATGGCCATGAGTGGG - Intronic
967188705 3:186967015-186967037 GATCTGACAGGGACAAGAGGAGG + Intronic
968846780 4:3047551-3047573 GCTCAGACAGGGCCACTAGAGGG + Intergenic
969486438 4:7474898-7474920 AGACTGCCAGGGCCACCAGGAGG - Intronic
972321281 4:37975641-37975663 GCCCGGACAGGGCCACCAGGAGG - Intronic
972674075 4:41242498-41242520 TGTCAGACAGGGCCACGTGCAGG + Intergenic
984936792 4:184897148-184897170 GGTCATCCAAGGCCACGAGGAGG - Intergenic
989125493 5:38048696-38048718 GGGTTGACAGGGCCATGAGATGG + Intergenic
997660039 5:135582429-135582451 GATCTGACAGGGTGACGAGGTGG + Intergenic
1013274622 6:108572273-108572295 GCCCTGACAGGGCCAAAAGGAGG - Intronic
1019702379 7:2480231-2480253 GGCCTGACAGGGCGAGGAGCTGG - Intergenic
1022101765 7:27173433-27173455 GGGCTCGCAGGGCGACGAGGAGG - Exonic
1022505173 7:30905263-30905285 GATCAGACTGGGCCAGGAGGCGG + Intergenic
1034579511 7:152030292-152030314 GCTCGGACAGGGCCACCAGAGGG - Intronic
1034992568 7:155557522-155557544 GGGCTGAAGGGGCCGCGAGGTGG - Intergenic
1035859270 8:3010434-3010456 GGACTGATAGGGCCACGAGATGG - Intronic
1037981160 8:23255300-23255322 GCTCTGACAGGGCCACCACGGGG - Exonic
1041496034 8:58486309-58486331 AGTGTGCCAGGGCCACGGGGAGG - Intergenic
1046229175 8:111331091-111331113 GGTCTGTCAGGGACAGGTGGAGG - Intergenic
1046397374 8:113657654-113657676 TGTCTGAAAGGACCACCAGGAGG + Intergenic
1049324733 8:142016044-142016066 GGCCTGACAGAGGCAGGAGGTGG - Intergenic
1049655947 8:143797432-143797454 GTTCTGAGCGGGCCCCGAGGTGG - Intronic
1054928068 9:70608173-70608195 ACTCTGGCAGGGCCACGTGGTGG - Intronic
1055574067 9:77645558-77645580 GGTCAGACAGTGCCTCAAGGTGG + Intronic
1056762969 9:89427891-89427913 GGTCTGAGAGCTCCAGGAGGGGG + Intronic
1057392694 9:94652742-94652764 GATATGAAAGAGCCACGAGGAGG - Intergenic
1057780652 9:98047289-98047311 GGTCTCACAGTTCCACGTGGTGG - Intergenic
1058940838 9:109811349-109811371 GGTCAGAGAGGGACATGAGGTGG + Intronic
1059465826 9:114468340-114468362 GGTCTGACTTGGCCATGAGTTGG - Intronic
1060213560 9:121724932-121724954 GGTCTGAGAGGGCCAGGGGCAGG + Intronic
1061189120 9:129071434-129071456 GGGCTGACAGGACCCCGCGGCGG - Exonic
1061271554 9:129546627-129546649 GGTCTGACAGAGCCATGTGGTGG + Intergenic
1061946239 9:133909657-133909679 GGTCCGACTGGGCAAAGAGGGGG + Intronic
1062484228 9:136766586-136766608 GCCCTGACAGGGCCACCAGAGGG + Intergenic
1201718465 Y:17072297-17072319 GGTATGAGAGGGCCAGGAAGAGG + Intergenic