ID: 1160974324

View in Genome Browser
Species Human (GRCh38)
Location 19:1785225-1785247
Sequence TGGCGTAGAAACCAAGGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160974321_1160974324 6 Left 1160974321 19:1785196-1785218 CCAGAAGCTCTGGGTGGTGGTAG 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1160974324 19:1785225-1785247 TGGCGTAGAAACCAAGGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160974324 Original CRISPR TGGCGTAGAAACCAAGGCTG AGG Exonic
900603776 1:3514945-3514967 TGGCGCTGACACCAAGGCGGCGG + Intronic
902282329 1:15383636-15383658 TGGAGCAGATCCCAAGGCTGGGG + Intronic
902366274 1:15976238-15976260 TGGAAGAGAAACCAAGGCAGGGG - Intergenic
902408958 1:16201918-16201940 GGGTGCTGAAACCAAGGCTGGGG + Intronic
905798318 1:40827919-40827941 TAGCTTAGAAACCATGGCTGTGG + Intronic
907114265 1:51955305-51955327 TGCTGTAGAACCCAGGGCTGTGG - Intronic
912496359 1:110094629-110094651 TGGAGTACAGACCCAGGCTGAGG + Intergenic
912511599 1:110193702-110193724 TGGGGAAGAAACCAGGGCAGTGG - Intronic
912836624 1:113001964-113001986 TGGCTTAGAAAGCAAGTCTATGG + Intergenic
916462548 1:165041936-165041958 TAGCACAGAAACCAAGGCAGAGG - Intergenic
917754611 1:178086771-178086793 TTGGATAGAAACCAAAGCTGTGG - Intergenic
918333005 1:183477921-183477943 TGGCTTAGAAAACAACCCTGTGG - Intronic
922062659 1:222107026-222107048 TGTTGTAGAAACAAGGGCTGTGG - Intergenic
922479332 1:225928150-225928172 TGCCTTAGAAACCAAGGCAGTGG - Intergenic
922695579 1:227729326-227729348 TGGCCTAGAAGCCAAGGGTAGGG - Intronic
922778040 1:228226395-228226417 AGGGGTGGAAACCCAGGCTGTGG - Intronic
1062899056 10:1127990-1128012 TGGAGGCAAAACCAAGGCTGTGG - Intronic
1063198934 10:3768889-3768911 TGGCGTAGAAGGCATGTCTGTGG + Intergenic
1064439422 10:15340301-15340323 TGGCAGATACACCAAGGCTGGGG + Intronic
1066648915 10:37637488-37637510 TGGCCTAGAAGCCAATGCTCAGG + Intergenic
1069826504 10:71258116-71258138 AGGCGGAGAAACCAAGGCCAGGG + Intronic
1069838212 10:71322698-71322720 GTGAGTAGAAACCAAGGCTGGGG - Intronic
1071091419 10:81923577-81923599 TGGAGGAGAAAACAAAGCTGGGG - Intronic
1073967075 10:109002894-109002916 TGCCTGTGAAACCAAGGCTGTGG + Intergenic
1074903444 10:117839499-117839521 TGCCGTAGAGACCAGGCCTGAGG + Intergenic
1077138111 11:1011628-1011650 CGGCCTAGGAGCCAAGGCTGGGG + Exonic
1077776339 11:5276052-5276074 TTGTGTAGAAACCAAGCGTGGGG - Intronic
1079740830 11:24058251-24058273 TGGTGAGGAAACCAAGGCTTAGG + Intergenic
1081322224 11:41705199-41705221 TGGGGTGGAAAGAAAGGCTGAGG + Intergenic
1082160740 11:48885397-48885419 TGGGGTAGAAACCAAGGACCAGG - Intergenic
1082161626 11:48895009-48895031 TGGGGTAGAAACCAAGGACCAGG + Intergenic
1082236370 11:49823261-49823283 TGGGGTAGAAACCAAGGACCAGG - Intergenic
1082239820 11:49857769-49857791 TGGGGTAGAAACCAAGGACCAGG - Intergenic
1082242331 11:49886582-49886604 TGGGGTAGAAACCAAGGACCAGG + Intergenic
1082609858 11:55283137-55283159 TGGGGTAGAAACCAAGGACCAGG - Intergenic
1082656824 11:55867387-55867409 TGGGGTAGAAACCAAGGACCAGG + Intergenic
1086157203 11:83680574-83680596 TGGATTAGAAACCAAGTCTCAGG + Intronic
1086192345 11:84094544-84094566 TGGCCTATAAACCAAGGCACTGG + Intronic
1088538468 11:110887072-110887094 GGGCCTAGAACCCAGGGCTGTGG - Intergenic
1088817798 11:113433406-113433428 TGGACTAGAGACCTAGGCTGGGG + Intronic
1089261767 11:117228521-117228543 TTTCCTAGAATCCAAGGCTGTGG - Intronic
1093923429 12:24885663-24885685 TGACTGAGAAACCAAGACTGTGG + Intronic
1094803248 12:34063289-34063311 TGGAGTAACAACCAAGGCTATGG + Intergenic
1095491235 12:42736071-42736093 ATGCGTACAAACCAAGGCTACGG - Intergenic
1095791302 12:46170355-46170377 GAACTTAGAAACCAAGGCTGAGG - Intergenic
1096676489 12:53229148-53229170 TGGTGGAGATACCCAGGCTGGGG - Intronic
1101404105 12:104412931-104412953 TGGGGAAGAGACCAGGGCTGTGG + Intergenic
1103244954 12:119448768-119448790 TTGCCTAGAAACCAGAGCTGTGG + Intronic
1103918034 12:124385975-124385997 TGGAGCAGAAACCCAGCCTGGGG + Intronic
1105211230 13:18258298-18258320 TGGGGCAGAAGCCAAGACTGGGG + Intergenic
1105441234 13:20416558-20416580 TGGCCTGGAAAGCAAGGGTGAGG - Intronic
1106319609 13:28625200-28625222 TGACTTAGATACCAAGTCTGTGG + Intergenic
1107333322 13:39325651-39325673 TTTGGTAGAAACCAAGGCTGAGG - Intergenic
1107981522 13:45738512-45738534 TGGGTGAGAGACCAAGGCTGCGG + Intergenic
1108568189 13:51722637-51722659 CAGTGTAGAAACCAAGGCTCAGG + Intronic
1110080217 13:71300068-71300090 TGACATAGAAACAAAGGCTGTGG - Intergenic
1115546458 14:34468776-34468798 TGTGGTAGAAACCAAGACTGTGG - Intergenic
1124885309 15:33679772-33679794 TGGTGAAGAAATCAAGGCTCTGG + Intronic
1128269350 15:66294309-66294331 TGGCCTAGAAACCAAGGACTGGG - Intronic
1128770951 15:70282064-70282086 TGGCTTAGAAGCCAATGCTTAGG - Intergenic
1130415089 15:83686038-83686060 TAGGGCAGAAACCCAGGCTGTGG - Intronic
1133354979 16:5129578-5129600 AGGCCTAAAAACCAACGCTGAGG - Intergenic
1134810837 16:17165959-17165981 TTGCACAGAAACCAAGCCTGTGG + Intronic
1138147698 16:54627109-54627131 TTGCGTAGAAGACATGGCTGTGG - Intergenic
1141908241 16:87041607-87041629 TGGAGGAGGAACCAGGGCTGGGG - Intergenic
1142486189 17:248926-248948 GGGCGAAGCAACCGAGGCTGAGG + Intronic
1146017697 17:29247085-29247107 TGCCCTAGCAACTAAGGCTGGGG + Intronic
1150025721 17:61672285-61672307 TTGGGTAGAAAACAAAGCTGAGG + Intergenic
1150819558 17:68424358-68424380 TGGCTTAGAAAACAAAGCTGCGG - Intronic
1152795182 17:82303038-82303060 TGGGGTAGAAACCCAGGCAGGGG + Intergenic
1157276027 18:46311768-46311790 TGGCTGAGAGACCAGGGCTGGGG - Intergenic
1159097547 18:63921530-63921552 TAGCGAAGAAAGAAAGGCTGTGG - Intronic
1160900637 19:1426280-1426302 GGTCGTGGAAACCAAGCCTGAGG - Intronic
1160974324 19:1785225-1785247 TGGCGTAGAAACCAAGGCTGAGG + Exonic
1161363693 19:3866971-3866993 GGGCTTGGAAACCAGGGCTGTGG - Intronic
1161502147 19:4622221-4622243 TGGCCAGGAAGCCAAGGCTGGGG + Intergenic
1162382405 19:10339343-10339365 TGGCGTACAAGCCTATGCTGGGG + Intronic
1163778749 19:19233950-19233972 TGGAGTACAACCCAAGGCTCTGG - Intronic
1166334192 19:42095622-42095644 GGCCGTCGAAACCCAGGCTGGGG + Exonic
925081093 2:1067754-1067776 AGATGGAGAAACCAAGGCTGAGG + Intronic
925125679 2:1453987-1454009 TGGCTTAGGAGCCAAGGCTCAGG + Intronic
928299334 2:30111663-30111685 AGGTGAAGAAACCAGGGCTGGGG + Intergenic
930247177 2:48996063-48996085 TTTCCTAGTAACCAAGGCTGAGG + Intronic
932809007 2:74808225-74808247 TGGGGTAGAAAGGAAGCCTGTGG - Intergenic
934589228 2:95531158-95531180 TGGGGTAGAAACCAAGGACCAGG - Intergenic
934985454 2:98881697-98881719 TGGTGCAGAAACCAAGCTTGTGG - Intronic
940770241 2:157831752-157831774 TGGAGTAGAAGCCAAGGATTGGG - Intronic
940890105 2:159026984-159027006 AGGAGAGGAAACCAAGGCTGTGG - Intronic
944134482 2:196383706-196383728 TGGAGTTGAAAGCTAGGCTGAGG + Intronic
946371743 2:219285443-219285465 TGGCACAGAAACCAGGGTTGGGG - Exonic
946631504 2:221674199-221674221 TGGTGTAGAAACCATAGATGAGG + Intergenic
1169280919 20:4266337-4266359 AGGAGAAGAAGCCAAGGCTGTGG + Intergenic
1169944792 20:10977248-10977270 TGCCCTAGACTCCAAGGCTGAGG - Intergenic
1172511233 20:35502458-35502480 TGTCGTAGAAGCCAGGGCTCAGG + Exonic
1173570993 20:44075944-44075966 TGGCGTAGGCCCCAGGGCTGAGG - Intergenic
1173875851 20:46370986-46371008 AGGAGAAGAAACCAAGGCAGAGG + Intronic
1175396755 20:58669642-58669664 TGGGGTACCGACCAAGGCTGGGG + Intronic
1178294149 21:31394864-31394886 GGAAGAAGAAACCAAGGCTGTGG - Intronic
1180604425 22:17046305-17046327 TGGGGTAGATGCCAGGGCTGGGG - Intergenic
1180765006 22:18341139-18341161 TGGGGCAGAAGCCAAGACTGGGG - Intergenic
1180814023 22:18778545-18778567 TGGGGCAGAAGCCAAGACTGGGG + Intergenic
1181035270 22:20166936-20166958 TGGCCTGGACACCAAGGATGAGG + Intergenic
1181200208 22:21212880-21212902 TGGGGCAGAAGCCAAGACTGGGG + Intronic
1183300679 22:37057577-37057599 TGGTGGGGAACCCAAGGCTGGGG - Intronic
1183586105 22:38754066-38754088 TGGGGCAGAAATCAAGGCTCTGG + Intronic
1183715519 22:39531117-39531139 TGTGGTGGACACCAAGGCTGCGG + Intronic
1203226629 22_KI270731v1_random:82044-82066 TGGGGCAGAAGCCAAGACTGGGG - Intergenic
1203264122 22_KI270734v1_random:4232-4254 TGGGGCAGAAGCCAAGACTGGGG + Intergenic
950185089 3:10939882-10939904 TAGCTCAGAAACCAAGGCAGAGG - Exonic
953244457 3:41178063-41178085 TGGCTTAGAACCCAAGAGTGGGG + Intergenic
954114784 3:48460428-48460450 TGGGGTAGAGACCAACCCTGAGG + Exonic
959966746 3:112364230-112364252 TAGAGGAGAAAGCAAGGCTGTGG - Intergenic
960537266 3:118827578-118827600 ATACGTAGAAACCAAGGCTCGGG - Intergenic
960979425 3:123208601-123208623 TGGCATGGGAACCCAGGCTGAGG + Exonic
962331454 3:134482693-134482715 TGGCAAAGAAATCAAAGCTGTGG - Intronic
962705343 3:138038131-138038153 AGGTGAAGAAACCAAGGCTCAGG + Intergenic
963107440 3:141659390-141659412 GGGCGTAGAAAGGAAGGCTTGGG - Intergenic
965148860 3:164944060-164944082 TGTCATAGAAACGAAGGCTCAGG + Intergenic
965359464 3:167720095-167720117 GGGCATAGAAACCATGGATGTGG + Exonic
965469433 3:169072599-169072621 TCACTTAGAGACCAAGGCTGAGG + Intergenic
965981938 3:174703728-174703750 TAGCATAGAAACCAAGACAGGGG + Intronic
975747966 4:77493135-77493157 TGGGGTAGAGACCATGGCTATGG + Intergenic
978239789 4:106501853-106501875 AGGGGTAGAAAGGAAGGCTGAGG + Intergenic
981294687 4:143118042-143118064 TAGAGAAGAAACCCAGGCTGGGG + Intergenic
982221101 4:153125945-153125967 TGGCTTAGGAAACCAGGCTGAGG - Intergenic
984473042 4:180201601-180201623 TGGCCTAGAACGAAAGGCTGAGG - Intergenic
985534196 5:454169-454191 TGGGCTGGAAACCAAGGCTGTGG - Intronic
986734175 5:10655840-10655862 TGGGGTAGAAACCAAGGACCAGG - Intergenic
991198292 5:63960903-63960925 GGGCGTGGAGAGCAAGGCTGGGG - Exonic
992881920 5:81118613-81118635 GGGAGTGCAAACCAAGGCTGTGG - Intronic
993234203 5:85281680-85281702 TGTTGCAGAAACCAATGCTGGGG + Intergenic
998820788 5:146056005-146056027 TGGTGTAGAGACCAGGGCTCCGG - Exonic
1001084811 5:168692876-168692898 TGCCAAAGAAACCAAGGCAGAGG - Intronic
1001381818 5:171310602-171310624 TGGAGGAGAAACCAAGGCGTGGG - Intronic
1008039842 6:46785803-46785825 TGGATGAGAAACCAATGCTGAGG - Intergenic
1014786166 6:125621922-125621944 TGGCGGAGAAAGCAATTCTGAGG - Intergenic
1016377471 6:143437734-143437756 TGGTGTTGATACCAGGGCTGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1018433364 6:163740816-163740838 TTGAGTTGAAACCTAGGCTGTGG - Intergenic
1020012645 7:4815193-4815215 TGGCTCACAAACCAAGCCTGGGG - Intronic
1022856355 7:34318743-34318765 GGGAGTAGAAGCCAAGACTGGGG + Intergenic
1026852864 7:73735805-73735827 TGGAGGAGAAACTGAGGCTGAGG + Intergenic
1029582613 7:101447546-101447568 TGGCGTGGAAACCACTGCCGGGG - Intronic
1029589604 7:101498603-101498625 TGCCGGCGACACCAAGGCTGTGG + Intronic
1030332996 7:108293132-108293154 GGGGGTGGAAACCAAGGATGAGG - Intronic
1030391762 7:108937310-108937332 TGGTGAGGAAACCAAGGCTCAGG + Intergenic
1032681692 7:134191151-134191173 TGGCAAAGACACTAAGGCTGTGG + Intronic
1035788968 8:2286325-2286347 TGGCGTAGAAGCCAAGAGGGGGG + Intergenic
1035803837 8:2435380-2435402 TGGCGTAGAAGCCAAGAGGGGGG - Intergenic
1041143493 8:54846889-54846911 TGGCACAGAAACCAGAGCTGTGG - Intergenic
1041256326 8:55982545-55982567 TGGCGTGGACTCCAAAGCTGGGG - Intronic
1047296714 8:123576717-123576739 TGGCTTAAAAACCAAAGCAGAGG + Intergenic
1055036242 9:71821506-71821528 TGAAGTAGAAAACAAGGCAGCGG + Intergenic
1059836757 9:118163275-118163297 TGGCTTACAAAACAAAGCTGTGG - Intergenic
1061431215 9:130532595-130532617 TTGCTTAGAAACCCAGCCTGAGG - Intergenic
1061947630 9:133917667-133917689 TGACGGGGAAACCAAGGCTTAGG + Intronic
1062391725 9:136336544-136336566 AGGCGAGAAAACCAAGGCTGGGG + Intronic
1188876624 X:35438935-35438957 GAGCGTAGACACCAAGGGTGAGG + Intergenic
1190017169 X:46836953-46836975 TGGCGGGCAAACTAAGGCTGCGG + Exonic
1190816204 X:53932122-53932144 TGAGGTATAAACCAAGTCTGTGG - Intergenic
1190947825 X:55113076-55113098 TGGGATATAAACCCAGGCTGTGG - Intronic
1192221641 X:69201230-69201252 TGGCGCAGAAAGGTAGGCTGGGG - Intergenic
1200884456 Y:8253991-8254013 TGGAGGAGAAACCCGGGCTGCGG + Intergenic
1200954084 Y:8927874-8927896 TGGAGGAGAAACCTGGGCTGCGG - Intergenic
1202107416 Y:21385402-21385424 TGGAGGAGAAACCCGGGCTGCGG + Intronic
1202195817 Y:22297614-22297636 TGGAGGAGAAACCCGGGCTGCGG + Intergenic
1202199529 Y:22331718-22331740 TGGAGGAGAAACCCAGGCCGCGG - Intronic