ID: 1160977385

View in Genome Browser
Species Human (GRCh38)
Location 19:1799946-1799968
Sequence TGCATCAGCGGCCGCGTCTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160977385_1160977387 -9 Left 1160977385 19:1799946-1799968 CCATAGACGCGGCCGCTGATGCA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1160977387 19:1799960-1799982 GCTGATGCAGCACTTGTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160977385 Original CRISPR TGCATCAGCGGCCGCGTCTA TGG (reversed) Exonic