ID: 1160977387

View in Genome Browser
Species Human (GRCh38)
Location 19:1799960-1799982
Sequence GCTGATGCAGCACTTGTTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160977378_1160977387 22 Left 1160977378 19:1799915-1799937 CCCAGCTGGGAGCTCAGGTGTCG 0: 1
1: 0
2: 0
3: 21
4: 132
Right 1160977387 19:1799960-1799982 GCTGATGCAGCACTTGTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1160977379_1160977387 21 Left 1160977379 19:1799916-1799938 CCAGCTGGGAGCTCAGGTGTCGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1160977387 19:1799960-1799982 GCTGATGCAGCACTTGTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1160977384_1160977387 -4 Left 1160977384 19:1799941-1799963 CCGCACCATAGACGCGGCCGCTG 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1160977387 19:1799960-1799982 GCTGATGCAGCACTTGTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1160977385_1160977387 -9 Left 1160977385 19:1799946-1799968 CCATAGACGCGGCCGCTGATGCA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1160977387 19:1799960-1799982 GCTGATGCAGCACTTGTTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160977387 Original CRISPR GCTGATGCAGCACTTGTTGA AGG Exonic