ID: 1160978372

View in Genome Browser
Species Human (GRCh38)
Location 19:1805431-1805453
Sequence GACCAACTTGAAGTTCAGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160978372_1160978378 1 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978378 19:1805455-1805477 CCCTGGTGACGAGGAGAGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 313
1160978372_1160978380 4 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978380 19:1805458-1805480 TGGTGACGAGGAGAGGAGGGAGG 0: 1
1: 0
2: 8
3: 113
4: 844
1160978372_1160978376 0 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978376 19:1805454-1805476 TCCCTGGTGACGAGGAGAGGAGG 0: 1
1: 0
2: 4
3: 21
4: 259
1160978372_1160978382 22 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978382 19:1805476-1805498 GGAGGTGAAAGTGGAGTTGATGG 0: 1
1: 0
2: 8
3: 107
4: 795
1160978372_1160978375 -3 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978375 19:1805451-1805473 GTCTCCCTGGTGACGAGGAGAGG 0: 1
1: 0
2: 2
3: 13
4: 161
1160978372_1160978374 -8 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978374 19:1805446-1805468 AGTTGGTCTCCCTGGTGACGAGG 0: 1
1: 0
2: 1
3: 5
4: 77
1160978372_1160978381 13 Left 1160978372 19:1805431-1805453 CCTGTCTGAACTTCAAGTTGGTC 0: 1
1: 0
2: 0
3: 13
4: 134
Right 1160978381 19:1805467-1805489 GGAGAGGAGGGAGGTGAAAGTGG 0: 1
1: 0
2: 29
3: 263
4: 2502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160978372 Original CRISPR GACCAACTTGAAGTTCAGAC AGG (reversed) Exonic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
902830142 1:19007331-19007353 GAGCAAATTGAGGTTCAGAGAGG + Intergenic
904648816 1:31988713-31988735 GAGGAAATTGAAGCTCAGACAGG - Intergenic
905269858 1:36780775-36780797 GAGAAAATTGAAGTTCAGAGAGG + Intergenic
915162711 1:153931414-153931436 GACCAAATTGAGGCTCAGAGTGG + Intronic
917571354 1:176268608-176268630 CACCAACTGGAATTTCAAACGGG - Intergenic
918270115 1:182890150-182890172 GCCCTTCTAGAAGTTCAGACAGG + Intergenic
1064995624 10:21294580-21294602 GACCATTTCAAAGTTCAGACAGG + Intergenic
1066344339 10:34568770-34568792 GAGGAAATTGAAGTTCAGAGAGG - Intronic
1066677786 10:37906440-37906462 TTTCAACATGAAGTTCAGACAGG - Intergenic
1069087302 10:64156127-64156149 GAACATCTTGAAGATCAGAAAGG + Intergenic
1069123728 10:64603458-64603480 GACCAGCTTGCAGATCATACTGG - Intergenic
1071936170 10:90532588-90532610 GAGGAACTTGAAGTTTAGAGGGG + Intergenic
1072736029 10:97880285-97880307 GACCAACAAGAAGTGCAGTCGGG - Exonic
1077441986 11:2573184-2573206 CACCATCTTGAAGTTCTGAATGG + Intronic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1080387157 11:31816943-31816965 GACTAACTTGTGGTTCAGCCGGG - Intronic
1086254023 11:84853100-84853122 GAAAAACTTGAGGTTCAGAGTGG + Intronic
1088795277 11:113262121-113262143 GTCCAACTTGTAATTCAGAGAGG - Intronic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1094217380 12:27957833-27957855 ATTCAATTTGAAGTTCAGACAGG - Intergenic
1098297177 12:69015737-69015759 GACTAACTTTATGTTCAAACTGG + Intergenic
1099596801 12:84676693-84676715 GACCAACATTAAATTCATACAGG - Intergenic
1099791163 12:87335702-87335724 GTCAAACTTGAAGTTTAGATTGG + Intergenic
1099887923 12:88554936-88554958 GACCAACTTGGAGTCCAAATTGG + Intronic
1100035844 12:90250561-90250583 TAAAAACTTGAAGTTCAGACTGG + Intergenic
1102428204 12:112861232-112861254 GAGCAAATTGAAGTCCAGAGAGG + Intronic
1102550151 12:113685693-113685715 GAGCAACTGGAGGTTCACACGGG + Intergenic
1102804079 12:115763968-115763990 GAGGAAATTGAAGTTCAGAGAGG + Intergenic
1103344301 12:120239043-120239065 GCCCATCTTTATGTTCAGACAGG + Intronic
1106854436 13:33833846-33833868 AACAAACCTGAAGTTCAGACAGG - Intronic
1107107909 13:36666670-36666692 GAGCAACGTGAAGAGCAGACGGG - Intergenic
1107641946 13:42452934-42452956 AACCACCTGGAAGTTCAGACTGG - Intergenic
1107968829 13:45622145-45622167 AGCCACCTTGAAGTTCAGACTGG - Intergenic
1108998324 13:56763519-56763541 AGCCACCTGGAAGTTCAGACTGG + Intergenic
1110697272 13:78505650-78505672 GACAAACTTTAAGTTCTTACTGG - Intergenic
1111013570 13:82346036-82346058 GAACAAATTAAAGTTAAGACAGG + Intergenic
1111654946 13:91140617-91140639 GAACAACTTGAAGTGCAGAGGGG - Intergenic
1113516031 13:110899522-110899544 GGTCAACTTGAGGTTCAAACTGG + Intronic
1115363042 14:32525417-32525439 GACCAATTAGAAGTTCTGTCAGG - Intronic
1117764528 14:59067295-59067317 GACCAGCTTGATGTCTAGACAGG - Intergenic
1120970549 14:90203498-90203520 GGACAACTTGAAGTGCAGATAGG - Intergenic
1127541621 15:59944632-59944654 GAATAAATTGAAGTTCAGAGAGG + Intergenic
1128377909 15:67090330-67090352 CCCCAAGTTGAAGTTCAGAGAGG - Intronic
1139846425 16:69924743-69924765 GAGCAACTTCAGGTTCAGGCAGG + Intronic
1142559718 17:802871-802893 GACCAACTGGAGGTACAGATGGG + Intronic
1142815694 17:2423346-2423368 GAACAAGTTCAGGTTCAGACAGG - Intronic
1146621449 17:34401633-34401655 AACAGACTTGAATTTCAGACTGG - Intergenic
1147480063 17:40752278-40752300 TAACAGCTTGCAGTTCAGACAGG - Intronic
1150837601 17:68578638-68578660 GACCAAGGGGAAGTTTAGACAGG + Intronic
1151345652 17:73499720-73499742 GAAGAACCTGAAGTTCAGAGAGG - Intronic
1151575050 17:74948991-74949013 GACCCATCTGAAGTTCAGGCTGG + Intronic
1153314465 18:3708383-3708405 CACCAAGTTGAAGTTCATATGGG + Intronic
1156407739 18:36798861-36798883 GACCATCTGGAAGTCCAGTCAGG + Intronic
1159901779 18:74053627-74053649 AGCCACCTGGAAGTTCAGACTGG + Intergenic
1159981105 18:74781140-74781162 TACCAACTGGAAGTGAAGACAGG + Intronic
1160391090 18:78533760-78533782 GGCCAAACTGAAGATCAGACAGG - Intergenic
1160978372 19:1805431-1805453 GACCAACTTGAAGTTCAGACAGG - Exonic
1162086192 19:8250772-8250794 GATGAACTTGAGGTTCAGAGAGG + Intronic
1166006761 19:39913536-39913558 GAAGAAATTGAAGTTCAGAAAGG - Intronic
932134767 2:69218684-69218706 AACCAACTTGAAAATCACACTGG + Intronic
936820491 2:116514166-116514188 GACTGACTTGAAATTCAGCCAGG + Intergenic
939804568 2:146757290-146757312 GACAAACTTGAAGCACAGAGAGG - Intergenic
946305310 2:218853549-218853571 GACAAAATGGAAGTTGAGACTGG + Intergenic
1170248007 20:14245466-14245488 GAGAAACTTGAAGCTCAGAGAGG + Intronic
1170617251 20:17963816-17963838 GACCAAGGTTAAGTTCAAACAGG - Intronic
1171459415 20:25290503-25290525 GACCAACTTGATGATCAGCTTGG - Exonic
1172822413 20:37749098-37749120 AGCTAACTTGAAGTTAAGACAGG + Intronic
1173674296 20:44820555-44820577 GACCAAATTAAAGCTCAGAGAGG - Intergenic
949499110 3:4662064-4662086 GACCACCTTGAATTTCAGATTGG + Exonic
950065842 3:10111085-10111107 GACCAACTCAAAGTGAAGACAGG + Intergenic
950555847 3:13695541-13695563 AACAAACTTGCAGTTCAGTCCGG + Intergenic
952473768 3:33684539-33684561 GACCAACTTGAAGCTCTAAGTGG + Intronic
955338293 3:58105080-58105102 GGCCAACTTGAACTTCAAAGGGG - Exonic
955540254 3:59968349-59968371 GACCACCTTAAAGTTCATATAGG - Intronic
964819782 3:160756446-160756468 GACCATCGTGAAGTCCAGCCGGG + Exonic
966940295 3:184741808-184741830 GAGGAACTTGAAGTTCAGAGAGG + Intergenic
969215888 4:5722119-5722141 GAGAAACTTGAGGCTCAGACAGG - Intronic
969605053 4:8198202-8198224 GACCAACAAGAAGATAAGACTGG - Intronic
970515498 4:16825454-16825476 GACCCACATGAATTACAGACTGG - Intronic
974126889 4:57707523-57707545 GACCAGCTGGTAGTCCAGACAGG - Intergenic
975823153 4:78291955-78291977 GAAAAAATTGAAGTTCAGAGAGG - Intronic
976037288 4:80839409-80839431 GACCAATTTGAAGTACAAAAAGG + Intronic
976911996 4:90318946-90318968 GACCATCTCTAAGTTCAGAATGG + Intronic
978416609 4:108483436-108483458 GACAAACTTCAATTTCAGAAGGG + Intergenic
981592857 4:146383719-146383741 GAGAAACCTGAAGTTCAGAAAGG + Intronic
983583064 4:169328031-169328053 GAGCAAACTGAAGTTCAGAGAGG + Intergenic
985276957 4:188246392-188246414 GGCCTGTTTGAAGTTCAGACGGG - Intergenic
988137587 5:27193813-27193835 GAGCAATTTGAATTTCAGAGTGG + Intergenic
990164835 5:52982844-52982866 GAACAAATGGAAGTTCAGTCTGG - Intergenic
991388767 5:66119900-66119922 GATCAAGTTGAATTTCAGAATGG - Intergenic
992786190 5:80172971-80172993 GACCCACTTGAAGGTCTAACTGG + Intronic
993870803 5:93252154-93252176 GAAGAAATTGAAGTTCAAACTGG - Intergenic
998393735 5:141804901-141804923 GCCCGACTTGAAGTCCAGCCGGG - Intergenic
998672268 5:144367210-144367232 TAGCCACTTGAACTTCAGACAGG + Intronic
1000824248 5:166024369-166024391 GACCTACTTTAGGTTCAGCCTGG - Intergenic
1001546895 5:172575846-172575868 GAGGAAATTGAAGTTCAGAGAGG - Intergenic
1004581868 6:16962203-16962225 TACAAATTTGAAGTTCAGAGAGG - Intergenic
1005107150 6:22236056-22236078 TGCCAAGTTGAATTTCAGACCGG + Intergenic
1005498404 6:26409141-26409163 GACTAATTTGAAGTTAAGAAAGG + Intronic
1005775380 6:29125706-29125728 GAACATCTTAAAGTTCAGAATGG + Intergenic
1006109936 6:31738407-31738429 GGCCAGCTTGAAGATCAAACAGG + Intronic
1007263808 6:40582526-40582548 GACCAACCTGAGGAACAGACTGG - Intronic
1007901659 6:45419737-45419759 GACCAACTGGAAGCGCAGCCAGG - Intronic
1008109379 6:47476780-47476802 CAAGAAATTGAAGTTCAGACAGG + Intergenic
1008719163 6:54327842-54327864 AGCCACCTGGAAGTTCAGACTGG + Intronic
1011816113 6:91192930-91192952 TATGAACTTGAAGTTCAGAGGGG + Intergenic
1012137652 6:95578290-95578312 AAGCAACTTGAAGTACAGGCAGG + Intronic
1012605208 6:101149946-101149968 GAACAAATTGCAGCTCAGACAGG + Intergenic
1016866368 6:148771705-148771727 GACCATGTGTAAGTTCAGACAGG - Intronic
1017308918 6:152954135-152954157 GACCAACTGGAATTTCAGATTGG - Intergenic
1018726306 6:166615744-166615766 GACCATCTTGAACATCAGAGAGG + Intronic
1022172545 7:27843756-27843778 GAGCAATTTGAAGCTCAGAGAGG - Intronic
1023183178 7:37506807-37506829 GAAAAACTTGAAATTCAGAATGG + Intergenic
1023282052 7:38580930-38580952 GAAAAACTTGGAGTTTAGACTGG + Intronic
1026727165 7:72879093-72879115 GACAAAGGTGAAGTTCAGTCTGG + Intergenic
1027116666 7:75486527-75486549 GACAAAGGTGAAGTTCAGTCCGG - Intergenic
1027121986 7:75528347-75528369 GACAAACGTGAAGTTCAGTCCGG - Intergenic
1027275137 7:76549070-76549092 GACAAAGGTGAAGTTCAGTCCGG + Intergenic
1028193016 7:87874455-87874477 TATAATCTTGAAGTTCAGACAGG - Intronic
1029585192 7:101466208-101466230 GAGCAAATGGAGGTTCAGACAGG - Intronic
1029720829 7:102363540-102363562 GACAAAGGTGAAGTTCAGTCCGG + Intergenic
1037771624 8:21804316-21804338 GAGGAAATTGAAGTTCAGAGAGG - Intronic
1038939215 8:32285247-32285269 GAGCAACCTGAAGTTCGGAGAGG + Intronic
1040358870 8:46645795-46645817 GACCAGCAAAAAGTTCAGACTGG + Intergenic
1040688169 8:49901750-49901772 AACCAAGTTGAAGATCAGCCTGG + Intergenic
1042241083 8:66665515-66665537 GAGGAACATGAAGTTCAGAAAGG + Exonic
1045243665 8:100424265-100424287 GATCAAATTGAAATACAGACAGG + Intergenic
1046155443 8:110283977-110283999 GACCATGTTGAAGCTCAGACTGG - Intergenic
1049282099 8:141754798-141754820 GACCAACTTGTTTTTCAGAATGG + Intergenic
1050800441 9:9605652-9605674 GATGAACTAGAAGTTGAGACTGG + Intronic
1051230309 9:14948909-14948931 CCCCAACTTGAAGTTCAGAGAGG + Intergenic
1053306655 9:36989068-36989090 GACCAACTTGCAGGTGTGACAGG + Intronic
1058183510 9:101826294-101826316 GACCAGCTTGAAAATCTGACAGG - Intergenic
1058200832 9:102038090-102038112 GACCAACTTAATTTTCAGAATGG - Intergenic
1058858141 9:109086892-109086914 GACCAAATTGAAATCCAGAGAGG - Intronic
1059426421 9:114223531-114223553 GGCCAAGGTGAAGTTCAGTCAGG - Intronic
1187256617 X:17648861-17648883 GAGGAAATTGATGTTCAGACAGG - Intronic
1188980930 X:36726462-36726484 GACCAAATTGAAGTAAAGAGAGG - Intergenic
1191698031 X:64009344-64009366 GCTCTAGTTGAAGTTCAGACTGG + Intergenic
1191866123 X:65705255-65705277 GGACAAGTTGAAGTTCAGAAGGG + Intronic
1192863989 X:75110217-75110239 GGCCAACTTGAATATCAGTCTGG - Intronic
1193367174 X:80649076-80649098 GAGAAAATTGAAGTTCAGAAAGG + Intergenic
1200830924 Y:7688369-7688391 GATCAACTTGTAGTTGAGGCCGG - Intergenic
1200897063 Y:8386968-8386990 GACCAACAAAAAGTTCAGATTGG - Intergenic