ID: 1160982599

View in Genome Browser
Species Human (GRCh38)
Location 19:1823248-1823270
Sequence CATGTCGGGGTACCTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160982599_1160982606 2 Left 1160982599 19:1823248-1823270 CCAATGCCAGGTACCCCGACATG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1160982606 19:1823273-1823295 TCCCCATTCCCTGGAACCACAGG 0: 1
1: 0
2: 1
3: 98
4: 2023
1160982599_1160982610 8 Left 1160982599 19:1823248-1823270 CCAATGCCAGGTACCCCGACATG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1160982610 19:1823279-1823301 TTCCCTGGAACCACAGGCTCAGG 0: 1
1: 2
2: 0
3: 24
4: 305
1160982599_1160982605 -7 Left 1160982599 19:1823248-1823270 CCAATGCCAGGTACCCCGACATG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1160982605 19:1823264-1823286 CGACATGGCTCCCCATTCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 112
1160982599_1160982613 14 Left 1160982599 19:1823248-1823270 CCAATGCCAGGTACCCCGACATG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1160982613 19:1823285-1823307 GGAACCACAGGCTCAGGCCCTGG 0: 1
1: 0
2: 2
3: 49
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160982599 Original CRISPR CATGTCGGGGTACCTGGCAT TGG (reversed) Intronic
900186007 1:1333576-1333598 CAGGTCTCGGTTCCTGGCATGGG + Exonic
900326668 1:2111555-2111577 CTTGCCGGGTCACCTGGCATTGG + Intronic
901198696 1:7454585-7454607 GAGGTCGGGGTGCCTGGCCTTGG - Intronic
902702485 1:18182023-18182045 CAAATGGGGGTGCCTGGCATAGG - Intronic
906543757 1:46607410-46607432 CATCTCAGGTTGCCTGGCATTGG - Intronic
910347471 1:86256696-86256718 CATGTCACAGTACCTGGGATGGG + Intergenic
915380134 1:155433179-155433201 CATGGCGGGACACCTGGCTTCGG + Intronic
916315984 1:163448023-163448045 CATGTCTAGTTCCCTGGCATGGG - Intergenic
921991725 1:221373851-221373873 CATGTCTAGAAACCTGGCATAGG + Intergenic
1062972887 10:1662055-1662077 CATGTCTGGGTCCCGGGCTTAGG - Intronic
1077778490 11:5298134-5298156 AAGGGCGGGGTCCCTGGCATGGG - Intronic
1083766331 11:64843254-64843276 CATGCCGGGGTCCCAGGCAGAGG + Intronic
1085151230 11:74254167-74254189 CATGTCTGGGCACCTGCCCTGGG + Exonic
1092396932 12:8134830-8134852 CATGGCGGGACACCTGGCTTCGG - Intronic
1095773714 12:45990420-45990442 CATGTTGGGGAACTTGGCAGCGG - Exonic
1106120805 13:26858830-26858852 CATGTGGGGGTACCCGTAATTGG + Intergenic
1107053747 13:36080418-36080440 CATGTCGGGTTATCTTACATAGG + Intronic
1118824158 14:69365380-69365402 TTTGTCTTGGTACCTGGCATTGG + Intergenic
1121946053 14:98123079-98123101 CATGGCGGGGAACCTGCCCTTGG + Intergenic
1126585038 15:50276763-50276785 CATGTCAGGGTACCTGGCTGTGG + Intronic
1128495565 15:68196579-68196601 AAGGTCGGGGTCCCTGGCCTCGG + Intronic
1129463559 15:75711836-75711858 CATGTTGGGGTTTCTGGCATCGG + Intronic
1129509212 15:76108244-76108266 CATGCCTGGATGCCTGGCATTGG + Intronic
1129721328 15:77879566-77879588 CATGTTGGGGTTTCTGGCATCGG - Intergenic
1134752306 16:16635704-16635726 CAGGTGGGGGGAGCTGGCATGGG - Intergenic
1139078629 16:63486293-63486315 CATGTAGGGGTAACTGTCCTTGG - Intergenic
1145969882 17:28950568-28950590 CACGTCCGGGTACCGGGCTTTGG - Intronic
1148193458 17:45696705-45696727 CAGGTGAGAGTACCTGGCATAGG - Intergenic
1151562821 17:74879690-74879712 CATGTGGGGGGACCTGGTAGAGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152261606 17:79270207-79270229 CATGGCGGGGGCCCTGGCAGAGG - Intronic
1155465132 18:26126062-26126084 CACGGTGGGGTACCTGGTATTGG - Intergenic
1156457075 18:37300845-37300867 CATCTGGGGGTGCCTGGCAGAGG + Intronic
1160765215 19:804567-804589 CCAGTCGGGGAACCTGGCCTTGG + Exonic
1160982599 19:1823248-1823270 CATGTCGGGGTACCTGGCATTGG - Intronic
926652811 2:15364720-15364742 CATGTCTGGGTACTTGGGCTGGG - Intronic
928226159 2:29449969-29449991 CATGTGTGGGCACATGGCATTGG + Intronic
929010266 2:37435078-37435100 TCTGTCTGGGTAACTGGCATTGG + Intergenic
930570298 2:53077730-53077752 GATGGCAGGGTACCTGGCAGGGG - Intergenic
931125164 2:59267174-59267196 AAAATCGGGGTACCTGACATCGG + Intergenic
933140993 2:78792733-78792755 CATGTAAGGGTTCCTGGCAAAGG + Intergenic
934780981 2:96969560-96969582 CTTGTCGGTGTGCCTGGCATTGG - Intronic
935537616 2:104312488-104312510 CATGCTGGGATACCTGGCAATGG - Intergenic
937182625 2:120010280-120010302 CTTTTCGGGGTACCTGGCCCAGG + Intergenic
941972404 2:171365731-171365753 CATGACAGAGTACCTGGCAATGG + Intronic
1170334944 20:15259345-15259367 AATGTGGGGGGAGCTGGCATAGG + Intronic
1170899109 20:20443495-20443517 CATTTAGGGGCACCTGGTATGGG - Intronic
1174406050 20:50304171-50304193 CATGTCTGAATACCTGGCAGTGG + Intergenic
1176410400 21:6446710-6446732 CCTGTCTGGGTATGTGGCATGGG - Intergenic
1179685893 21:43055032-43055054 CCTGTCTGGGTATGTGGCATGGG - Intronic
1182361621 22:29749725-29749747 CAGGTGGGGGTAACTGACATGGG + Intronic
1184933648 22:47701701-47701723 CATGCATGGATACCTGGCATAGG + Intergenic
949995560 3:9613867-9613889 CATGTAGGAGTACCAGGCAAAGG - Intergenic
963909110 3:150800117-150800139 CATATCTGGGTACCTTTCATAGG - Intergenic
965324268 3:167282827-167282849 CATGTCGTGGTGCTTGGCTTTGG - Intronic
973826080 4:54708807-54708829 CCTGTCGGGGTTACTGGCAGGGG - Intronic
973947436 4:55973139-55973161 CATGGCTGGGTATCTGGCAGGGG - Intronic
976449716 4:85174344-85174366 GTTGTCTGGGTACCTGGCCTTGG - Intergenic
987838543 5:23192259-23192281 CATGACTGGGTACCATGCATTGG + Intergenic
988331774 5:29850452-29850474 CATGCCAGGGTCCCTGGCAGGGG - Intergenic
988899115 5:35712376-35712398 CATGTCACTGTACCTGGCTTTGG + Intronic
1003904808 6:10689348-10689370 CAAGGCAGGGTAACTGGCATTGG + Intronic
1006029817 6:31170599-31170621 CATGGCGGGACACCTGGCTTCGG - Exonic
1007170668 6:39861043-39861065 CATCTCAGGGTTCATGGCATGGG + Intronic
1008345777 6:50424536-50424558 CATGTTGGGGTGCCTGGGGTAGG + Intergenic
1024911908 7:54456228-54456250 CATGTTGGGGCAGCTGGCAGAGG - Intergenic
1028800792 7:94963863-94963885 CATTGTGGGGAACCTGGCATTGG + Intronic
1030360502 7:108590421-108590443 TATGTTGGGTTACCTGGCAAGGG + Intergenic
1032711744 7:134466870-134466892 CTTGCCTGGGTACCTGGCCTCGG - Intergenic
1036635973 8:10549644-10549666 CATGTTAGGGTACCAGGCAGGGG + Intronic
1037302716 8:17469620-17469642 CCTGTCAGGATAACTGGCATTGG + Intergenic
1047697204 8:127415866-127415888 CATGGCGGGACACCTGGCTTCGG + Exonic
1049264643 8:141660896-141660918 CATGTGTGGGTACGTGGCAGAGG + Intergenic
1061019306 9:128003868-128003890 CATGTCGGTGTTGCTGCCATGGG + Intergenic
1062037978 9:134391142-134391164 CATGTCCTGGGGCCTGGCATGGG - Intronic
1187869321 X:23751296-23751318 CATGTCAGGGGACTTGGCATTGG + Intronic
1200865336 Y:8037651-8037673 AATTTTGGGGCACCTGGCATAGG - Intergenic