ID: 1160982677

View in Genome Browser
Species Human (GRCh38)
Location 19:1823529-1823551
Sequence TGCCCACGGCCCCCCGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160982670_1160982677 -5 Left 1160982670 19:1823511-1823533 CCACCTCTCCTGCCCACATGCCC 0: 1
1: 0
2: 10
3: 128
4: 1035
Right 1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 207
1160982671_1160982677 -8 Left 1160982671 19:1823514-1823536 CCTCTCCTGCCCACATGCCCACG 0: 1
1: 0
2: 4
3: 46
4: 436
Right 1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 207
1160982669_1160982677 5 Left 1160982669 19:1823501-1823523 CCTCAGGGTGCCACCTCTCCTGC 0: 1
1: 0
2: 2
3: 38
4: 326
Right 1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG 0: 1
1: 0
2: 0
3: 12
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160982677 Original CRISPR TGCCCACGGCCCCCCGGCAC AGG Intronic
900139674 1:1134455-1134477 TGCACACGGCCCCGCGACACGGG + Intergenic
900191830 1:1355384-1355406 TGCCCCCGACCCCGCGGCCCCGG + Intronic
900392751 1:2440876-2440898 TGGCCACGTCCCCCCGGGAACGG + Intronic
900461281 1:2803154-2803176 TGCCCGGGGCCCACAGGCACTGG + Intergenic
901054354 1:6441854-6441876 TGCCCTCCCCCCCCCAGCACAGG + Intronic
901081087 1:6584610-6584632 TGCCCCAGGACCCCCGACACTGG - Intronic
902385283 1:16072712-16072734 TGCCCTGGGCCCCCAGGCAAGGG + Intronic
903070906 1:20726675-20726697 TGCCCACGGCCCACCAGCCAGGG + Intronic
905028352 1:34865967-34865989 TGCGCCCGCCCCACCGGCACCGG - Exonic
907341579 1:53739275-53739297 TGGCCGCGGCCGCCCGGCTCAGG + Intergenic
912517550 1:110225813-110225835 TGCCCTCTGCTCCCCGGCTCTGG + Intronic
921138819 1:212285973-212285995 GCCCCACGGCCCTCCGGCCCCGG - Exonic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923976483 1:239270246-239270268 TGCCCAAGGGCCCCAGGTACTGG - Intergenic
924545190 1:245020054-245020076 CGCCCCCCGCCCCCAGGCACTGG + Intronic
1071497007 10:86175539-86175561 TGCCCACTGCCCCACTGCAACGG + Intronic
1071545008 10:86522129-86522151 AGCCCGCGGTCCCCAGGCACCGG - Intergenic
1075335226 10:121604032-121604054 TGCCCACTGCTCCCCAGCAGCGG + Intergenic
1076110130 10:127853872-127853894 TCCCCACTGCCCTCCTGCACAGG - Intergenic
1076372605 10:129964840-129964862 TGCCCAGGGCTCCCCGGCCAAGG + Intergenic
1076494234 10:130886327-130886349 TGTCCACGGCCCACAGGCCCAGG - Intergenic
1076888474 10:133273111-133273133 TGGCCACGCTCCCCCAGCACTGG - Intronic
1076920055 10:133446520-133446542 TGCCCGGGGCCCCCGGGCCCAGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077253760 11:1571824-1571846 CGCCCTCCGCCCCCCGGCCCGGG + Intronic
1077414360 11:2417949-2417971 TGCCCACCGCCCACCGGGCCCGG + Intronic
1078188715 11:9074324-9074346 TGCCCACGGTTACCCGGCAGTGG + Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1079863395 11:25703443-25703465 TGCCCCCTGCCCCCCGCAACAGG - Intergenic
1084000160 11:66291793-66291815 TGACCCCGCCCCCGCGGCACCGG - Intergenic
1084189752 11:67493587-67493609 TGCCCCCGCCCCACAGGCACTGG - Exonic
1085384557 11:76149703-76149725 TGCCCCCGGCCCTCAGACACAGG - Intergenic
1085618991 11:78023169-78023191 TGCCCCAGTCCCCCCGGCCCAGG - Exonic
1090647360 11:128776822-128776844 TGCCGACGTTCCCCCGGCCCTGG + Intronic
1091149539 11:133314758-133314780 TGCCCACGGCTCCCAAGCAATGG + Intronic
1091773413 12:3168530-3168552 TCCCCACCGCCCCCCAGCTCTGG - Intronic
1096254284 12:50053428-50053450 TGCCCAGGGCCACACAGCACTGG + Intergenic
1096551578 12:52376994-52377016 TGCCCACTTCCCCCCACCACTGG - Intergenic
1096776390 12:53966868-53966890 TGCCCACTGCCCACCGCCAAAGG - Intergenic
1103321555 12:120095469-120095491 TGCCCCCCGCCCACCGGCACAGG + Exonic
1103944786 12:124520018-124520040 TGGCCACGGGCCCCTGTCACAGG - Intronic
1104647865 12:130509718-130509740 TGCCCTCTGCCCCCCCGCCCCGG + Intronic
1104727086 12:131084746-131084768 TGCCCAGGGCCCGTGGGCACTGG - Intronic
1104928373 12:132325475-132325497 TGCCCACGGCCCCCCCTCTGGGG - Intronic
1104993561 12:132640484-132640506 TGACCAGGGCCCCCCGGAACGGG - Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1105697242 13:22900714-22900736 CGCCCACGCCCACCCGGAACTGG + Intergenic
1105801163 13:23903971-23903993 TTCCCACGGACCCCAGGCCCCGG - Intergenic
1105847714 13:24307965-24307987 TTCCCACGGACCCCAGGCCCCGG + Intronic
1112139540 13:96623314-96623336 TGCCCAGTGCCCCCCAGCACAGG - Intronic
1115235577 14:31206874-31206896 TGCCCACCGCGCCCCGCCGCCGG - Intronic
1117309831 14:54510137-54510159 GGCCCGCGGCCCTCCGGCTCCGG - Intronic
1117742603 14:58833970-58833992 AGCCCACGCCCACCCGGAACTGG - Intergenic
1117905777 14:60584133-60584155 TACCCTCCGCCCCCCGGCTCAGG - Intergenic
1118601381 14:67473244-67473266 TGACCACGGCCCCCCAACACCGG + Exonic
1120305278 14:82761922-82761944 TGCCCTCAACCCCCCAGCACAGG - Intergenic
1121414444 14:93769541-93769563 TGCCCACAGTCCCTCGTCACAGG + Intronic
1121731762 14:96192439-96192461 TGCCCAAGGACCCATGGCACTGG + Intergenic
1122533238 14:102443762-102443784 TGCTCACGCCCTCCCGGTACAGG - Exonic
1122713790 14:103680984-103681006 TGCCCACGAACCCCCTGCAGGGG - Intronic
1122784305 14:104156801-104156823 AGCCCACGTCCCCTCAGCACGGG + Intronic
1122834830 14:104425500-104425522 TGACCACAGCCCCTGGGCACAGG - Intergenic
1122953005 14:105056241-105056263 TGCCCCCCGCCGCCCGCCACAGG - Intronic
1123995615 15:25716150-25716172 TCCCCATGGCCCCACGGCCCAGG + Intronic
1124249316 15:28096832-28096854 TTCGCAGGGCCCCCCGGGACTGG + Intronic
1124631976 15:31343208-31343230 TGCACAGGGCCCGCCGGCTCAGG + Intronic
1124966164 15:34434820-34434842 TGCTCACGGCCACCTGGCAAGGG + Intronic
1125719967 15:41840557-41840579 TGCCCACGGCCTGCAGCCACAGG + Exonic
1129903623 15:79170627-79170649 TGCCCACTGACCCAGGGCACAGG + Intergenic
1131846082 15:96491923-96491945 TGCGCACCGCCCCCCGCCCCGGG - Intergenic
1132519582 16:381255-381277 CGCCCACGGGCCCCCGCTACAGG + Intronic
1132570138 16:640961-640983 AGCACAGGGCCCCCCGGCACAGG + Intronic
1132570170 16:641041-641063 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570194 16:641090-641112 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132570298 16:641384-641406 AGCACAGGGCCCCCCAGCACAGG + Intronic
1132656525 16:1043919-1043941 TGCCCACTGCCCCCAGGCCTGGG - Intergenic
1132681835 16:1145671-1145693 TGACCCCGGCCCCTCCGCACAGG + Intergenic
1132694128 16:1194571-1194593 TGCCTACAGCCCCCCAGCGCGGG + Intronic
1136362573 16:29790460-29790482 TGCTCAGCGCCGCCCGGCACTGG - Intergenic
1136845237 16:33571564-33571586 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1139853800 16:69965485-69965507 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1139882778 16:70188398-70188420 TCCCCACCGCCCCCCGGCCTCGG - Intergenic
1140369732 16:74407121-74407143 TCCCCACCGCCCCCCGGCCTCGG + Intergenic
1203106945 16_KI270728v1_random:1420217-1420239 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1203155405 16_KI270728v1_random:1871862-1871884 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
1142509740 17:386027-386049 TGCCCGCGCCCCGCCGGCCCCGG + Intronic
1142956586 17:3527077-3527099 TGCCTACGCCCCCCAGGCACAGG - Intronic
1143090320 17:4446065-4446087 TGCCCACGATGCCCCGGGACAGG - Exonic
1143105953 17:4530649-4530671 TGCCCACCAGCCCCCGGGACAGG - Exonic
1143119905 17:4600036-4600058 CTCCCCCGACCCCCCGGCACAGG - Intronic
1143502593 17:7347871-7347893 AGGCCACTGCCCCCCTGCACAGG + Intronic
1145269274 17:21396080-21396102 TGCCCTGGGCCCCCGGGCGCAGG + Intronic
1146052887 17:29567062-29567084 TGCCCAGGGCCCTCCCGCGCGGG + Exonic
1147244086 17:39109196-39109218 GGCCCCCGGCCTCCCAGCACAGG + Intronic
1152218342 17:79047381-79047403 TGCCCCCAGCCCCCTGCCACGGG - Intronic
1152231938 17:79118099-79118121 AGCCCAGGGCCGGCCGGCACTGG - Intronic
1152497304 17:80682584-80682606 TGCCCACGGCCACCAGAAACTGG + Intronic
1152518190 17:80838403-80838425 TGCCCCCGGCCGCACTGCACGGG + Intronic
1152727092 17:81952807-81952829 TGCCCACTGCCCTCCTGCCCCGG - Exonic
1152757949 17:82094896-82094918 TGCCCACGTCCCCCCACCCCAGG - Intronic
1152827944 17:82479285-82479307 TGCCCTCAGCCTCCAGGCACAGG - Intronic
1153854836 18:9136178-9136200 AGCCCGCGGCCCCCCGCCTCAGG - Intergenic
1160486828 18:79300589-79300611 TGTCCACGGCCCCGCAGCCCCGG - Intronic
1160757219 19:764112-764134 TGCACAGGGACCCCCAGCACTGG - Exonic
1160773937 19:846260-846282 TGCCCACGACCCCCCAGCCCAGG + Exonic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1161456823 19:4373780-4373802 TCCCCACGGCCCCCAGGCTGTGG + Intronic
1161723094 19:5914451-5914473 TGCCCGAGGCCCCGCGGGACAGG - Exonic
1161924977 19:7293669-7293691 TGGCCACCGCCCCCCGCCCCTGG + Intronic
1162363945 19:10236554-10236576 AGCCCCCCGCCCCCCGCCACCGG - Intergenic
1162758523 19:12874566-12874588 TGCCCGAGGCCCCCCGGGGCCGG + Exonic
1162904926 19:13817763-13817785 TCCCCAGGGCTCCCGGGCACAGG - Exonic
1165129050 19:33621183-33621205 GGCCCACGGCCACACAGCACCGG - Intergenic
1165149309 19:33751611-33751633 GGCCCACCGTCCCCGGGCACTGG + Intronic
1165838043 19:38771175-38771197 TCCCCAGGGCCACCCAGCACGGG - Intronic
1165841522 19:38791522-38791544 TCCCCAGGGCCACCCAGCACGGG + Intronic
1167507345 19:49877918-49877940 TGGCCCCGCCCCCCCGGCTCAGG + Exonic
1168078484 19:53992913-53992935 GGCCCGCGGCCCCCCGCCGCCGG - Exonic
1168112999 19:54205239-54205261 TGCCCACAGCCCCAGGGCCCTGG - Intronic
926681298 2:15665897-15665919 TCCCCACGCCTCCCCAGCACTGG + Intergenic
927636657 2:24821640-24821662 TCTCCACGGTCCCCTGGCACAGG - Exonic
928199062 2:29235574-29235596 TGCTCACTGCCACCTGGCACAGG + Intronic
929093719 2:38244706-38244728 TGCTCAGGGCCCCACAGCACTGG + Intergenic
932791053 2:74654642-74654664 CGCCCACGCCCCGCCGGGACCGG + Intronic
934976785 2:98808549-98808571 TGCCCCCTGCCCCCAGGCTCTGG + Intronic
936161120 2:110084876-110084898 GGACCACGGCTCCCCAGCACAGG + Exonic
936183543 2:110286478-110286500 GGACCACGGCTCCCCAGCACAGG - Intergenic
938547946 2:132352512-132352534 TGCCCCCGGCCCGCCCGCCCGGG + Intergenic
939652760 2:144785304-144785326 TGCCTACGGCACCAGGGCACTGG + Intergenic
943906140 2:193502718-193502740 AGCCCACGCCCACCCGGAACTGG + Intergenic
944482781 2:200174835-200174857 AGCCCACGCCCACCCGGAACTGG - Intergenic
947793163 2:232879158-232879180 TGCCCCTGGCCCCCAGGGACTGG - Exonic
1172113498 20:32560947-32560969 TGCCCACCGCCCCCAAGCTCCGG - Intronic
1172526191 20:35601769-35601791 GGCCCACGGCGCCGCGGCTCCGG - Intergenic
1172661971 20:36574191-36574213 TCCCCAGGGCCCCCCCGCTCCGG - Intronic
1175425676 20:58864487-58864509 TGCCCACTGCCCCCCAACATGGG + Intronic
1176200400 20:63857824-63857846 AGCCTCCGGCCCCCCGACACTGG - Intergenic
1178918444 21:36722740-36722762 AGCCCACGGCCCCCAGGAGCGGG + Intronic
1179187696 21:39097349-39097371 TCCCCACGGCCTCCCTGCCCTGG + Intergenic
1179220233 21:39400191-39400213 TGCTGACAGCCCCCCGGAACCGG + Intronic
1180612537 22:17107344-17107366 CACCCCCTGCCCCCCGGCACTGG + Intronic
1180703236 22:17793094-17793116 CGCCCACGGCCGCCAGGCAGGGG + Intronic
1182800851 22:33031095-33031117 TGCCCACGGCCCCCTGCCTAAGG + Intronic
1183409558 22:37646933-37646955 TGCCCAGGGCTCCCCGGATCAGG - Intronic
1183686185 22:39362576-39362598 TGCCAAGGGCCCCCCTTCACAGG - Intronic
1183949941 22:41347290-41347312 TGTCCACGGCCCCACGTCTCAGG + Intronic
1185092773 22:48785292-48785314 TGCCCATGACCCCCCGCCCCCGG + Intronic
1185203535 22:49523282-49523304 AGCCCACGGCCCCTTGGCCCAGG + Intronic
1185268788 22:49918865-49918887 TGTCCACCAGCCCCCGGCACCGG - Exonic
1185419614 22:50728188-50728210 TGCCAAAGGCCCCAGGGCACAGG - Intergenic
950486625 3:13277863-13277885 TGCCCTCAGCCCCCCGCCCCTGG + Intergenic
953718581 3:45336226-45336248 TGTCCACGTCCCTCTGGCACAGG + Intergenic
961170790 3:124796526-124796548 TGCCCTCTGCCTCCCGGCACAGG + Exonic
962383789 3:134916669-134916691 AGCCCACGCCCACCCGGAACTGG + Intronic
967166487 3:186784084-186784106 TGCCAACGGTTCACCGGCACCGG - Intronic
967527708 3:190514001-190514023 TGGCCACGGCCTCACGGCTCAGG - Intergenic
967917277 3:194588064-194588086 GACCCAAGGCCCCCCAGCACAGG + Exonic
968462751 4:733435-733457 AGCCCCCGGCTCCCCCGCACTGG - Intronic
968659893 4:1794562-1794584 CGCCCTCGGCCCCCAGGCAGGGG - Intronic
968705930 4:2077483-2077505 TGCCCACGGCCCCTGGCCAGAGG - Intronic
969114102 4:4860474-4860496 AGCCCACGGCTCCCTAGCACCGG - Intronic
972337430 4:38119896-38119918 TGCCCTGGGGCCCCAGGCACTGG + Intronic
973319131 4:48792430-48792452 TGCCCCCCGCACCCCCGCACAGG + Intergenic
984923106 4:184783115-184783137 TCCACACGGCACCCCGGAACAGG - Intronic
985493390 5:191907-191929 TGCCCAGCGCCCTCCCGCACGGG - Exonic
985631749 5:1017658-1017680 AGCCCACAGCCCCCCACCACGGG + Intronic
990557557 5:56951614-56951636 TGCCCCCGGCCCACCGGGCCCGG - Intronic
1001747571 5:174103528-174103550 TCCCCACCGCGCCCCAGCACTGG - Intronic
1002693140 5:181065060-181065082 TGCCTACAGCCCTCCTGCACTGG - Intergenic
1003213728 6:4090194-4090216 AGCCCACGCCCACCCGGAACTGG - Intronic
1015353207 6:132247086-132247108 TGCCCGTGACCTCCCGGCACCGG - Intergenic
1016859081 6:148698888-148698910 AGCCCACGCCCACCCGGAACTGG + Intergenic
1017310061 6:152966237-152966259 AGCCCACGCCCACCCGGAACTGG + Intergenic
1017826234 6:158084095-158084117 TGTCCCCGGCCCCACAGCACTGG + Exonic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019424882 7:969874-969896 TGTCCACGGCACCCTGGCAGAGG + Intronic
1019727752 7:2612446-2612468 TGCCCACGGCCCCAGGGCCTGGG + Exonic
1019748920 7:2716706-2716728 TGCCCAAGGCCCACCTGGACAGG + Intronic
1020116552 7:5479606-5479628 TGCCCACGGCCCCAGGGGGCAGG - Intronic
1026968374 7:74454131-74454153 TGCCAGCGGCGCCCCGGCCCCGG - Exonic
1028939003 7:96499441-96499463 GGCCAACTGCCACCCGGCACAGG - Intronic
1029381986 7:100220689-100220711 TGTCCACGTCCCCCTGACACTGG + Intronic
1029402148 7:100353139-100353161 TGTCCACGTCCCCCTGACACTGG + Intronic
1029438322 7:100574409-100574431 TGCCCCCGACCCCCTGCCACAGG - Intronic
1029483905 7:100827803-100827825 GGCCCAGGGACCCCCGGGACAGG + Intronic
1032119260 7:129144815-129144837 CGCTCCCGGCCCCCCGGCTCGGG + Intergenic
1032501684 7:132404448-132404470 TGCCCACTGCCCCCTGGCTCTGG - Intronic
1034433409 7:151051919-151051941 TGCCCACACCCCCCCAGCCCTGG - Intronic
1035526610 8:317837-317859 TGCCGACGGCCGCCCGGGTCTGG + Intergenic
1036191187 8:6671642-6671664 TGCCCCCGAACCCCCAGCACTGG + Intergenic
1037481965 8:19313802-19313824 TGCCCAGGGGCGCCCAGCACTGG + Exonic
1037816722 8:22116428-22116450 TGTCCATGTCCCCCCGACACAGG - Exonic
1040040319 8:42909923-42909945 TCCCCTCGGCCCCCCGCCTCTGG - Intronic
1042175237 8:66032190-66032212 TGGCCACTGCCTCCCAGCACTGG + Intronic
1043640146 8:82441474-82441496 AGCCCACGCCCACCCGGAACTGG - Intergenic
1044867837 8:96589894-96589916 TGCCTCTGGCCCCCCGGCTCTGG - Intronic
1045743361 8:105387599-105387621 AGCCCACGCCCACCCGGAACTGG + Intronic
1049475428 8:142794958-142794980 TGACCACAGCCCCTCGCCACAGG - Intergenic
1049705337 8:144039590-144039612 TGCCCACTGCCCCCAGCCATGGG - Intronic
1054258475 9:62838596-62838618 TACCCACGGCCCGCCCGCCCGGG - Intergenic
1054324402 9:63705912-63705934 TGCCCCCGGCCCGCCCGCCCGGG - Intergenic
1057168999 9:92949654-92949676 TGCCCAGGGCCACCAGGCAGCGG + Intronic
1057470020 9:95349266-95349288 TGCCCACGGCGTCCCGGTCCTGG + Intergenic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1060478128 9:124000176-124000198 CGCCCCCCGCCCCCCGGCCCTGG + Intergenic
1060985783 9:127818263-127818285 TGCCCTTGGCCGCCCGGCCCTGG + Exonic
1062098944 9:134718000-134718022 TGGCCGCGGCCCCCCAGCCCAGG - Intronic
1062419683 9:136474153-136474175 TGCCCCCGGCCCACCGCCTCAGG - Exonic
1062680354 9:137775811-137775833 TGCCCAGGGCCCCCCGAGAATGG + Intronic
1203775679 EBV:71893-71915 TGCCCCCGGCTCCACGGCCCCGG + Intergenic
1185782487 X:2861598-2861620 TGCACACGGCACGCCCGCACTGG - Exonic
1186405013 X:9294293-9294315 TGCCCCAGGCCCCCCTACACCGG + Intergenic
1189281175 X:39821117-39821139 AGCCCCCCGCCCCCCGCCACGGG - Intergenic
1194890505 X:99372345-99372367 AGCCCACGCCCCCCCGGAACTGG + Intergenic
1196283864 X:113856973-113856995 TGCCCCCCGCCCCCCGCCCCAGG + Intergenic
1196443911 X:115735612-115735634 TGCCCAAGGCCCCCGAGCCCAGG - Intergenic
1198388006 X:136147261-136147283 CGCCCACGTGCCCCCGCCACTGG - Intergenic
1200034583 X:153319300-153319322 TGCCCAGGCCTCCCCGGCCCAGG - Intergenic
1200173731 X:154097549-154097571 TGACCCCCGCCCCCCGGCAAGGG + Intronic
1200211796 X:154349913-154349935 TGTCCTCGGCCACCCAGCACAGG + Intronic