ID: 1160988001

View in Genome Browser
Species Human (GRCh38)
Location 19:1848410-1848432
Sequence GGCGACCGCGGCGCCAGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160988001_1160988013 23 Left 1160988001 19:1848410-1848432 CCCTCACTGGCGCCGCGGTCGCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1160988013 19:1848456-1848478 GCCGCCGCCATCTTGCTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1160988001_1160988017 30 Left 1160988001 19:1848410-1848432 CCCTCACTGGCGCCGCGGTCGCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1160988017 19:1848463-1848485 CCATCTTGCTCCGAGGCCCCCGG 0: 1
1: 0
2: 1
3: 19
4: 158
1160988001_1160988004 -5 Left 1160988001 19:1848410-1848432 CCCTCACTGGCGCCGCGGTCGCC 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1160988004 19:1848428-1848450 TCGCCGCCGCCCGCGCCTCACGG 0: 1
1: 0
2: 2
3: 23
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160988001 Original CRISPR GGCGACCGCGGCGCCAGTGA GGG (reversed) Exonic
900109093 1:998142-998164 GGCGACCGCGGCGCTGGTTCAGG + Intergenic
900119391 1:1042024-1042046 TGCGACCGCGTCACCTGTGACGG + Exonic
903132730 1:21290228-21290250 GGCGGCGGCGGCGCCAGGGTCGG - Intronic
903296102 1:22343915-22343937 GGCGACCGAGGCGGAGGTGAGGG + Intergenic
903907517 1:26696882-26696904 GGCGGCCGCGGCGGCGGCGACGG - Exonic
920309963 1:205043230-205043252 GGCGGCCGCGGCGGCGGTGGCGG - Exonic
920612340 1:207454226-207454248 GGCTGACGCGGCGCCGGTGAGGG - Exonic
1062885339 10:1011787-1011809 GGCCACCGCGGGGACAGTGAGGG - Intronic
1065025442 10:21535279-21535301 CGGGAACGCGGCGCCAGTGTGGG + Intronic
1072562254 10:96586974-96586996 GGCGACGGCGGCGGCAGAGGAGG - Exonic
1074890766 10:117735172-117735194 GGAGACTGCGGCGCCACGGAGGG + Intergenic
1075587256 10:123666814-123666836 GGCGAGCGCGGCGGCTGGGAAGG - Exonic
1075877821 10:125822860-125822882 CGCTACCGCTGCGCCGGTGACGG - Intronic
1078800893 11:14643627-14643649 GGCGGCCGCGGCGCGGGTGGCGG + Intronic
1081832054 11:46121977-46121999 GGCGGCGGCGGCGGCGGTGATGG + Intergenic
1083329625 11:61891495-61891517 GGCGGCCGCGGCGGCAGGGCGGG - Exonic
1085597167 11:77820681-77820703 GGCGGCAGCGGCGGCGGTGATGG - Exonic
1085597169 11:77820690-77820712 GGCGACGGCGGCGGCAGCGGCGG - Exonic
1092219000 12:6700410-6700432 GGGGACGGCTGCGCCAGGGAGGG + Exonic
1100978086 12:100142822-100142844 GGCGCCCGCGGCGGCCGTGGCGG - Exonic
1102519193 12:113468427-113468449 GGGGACAGCGGCGTCAGCGACGG + Intronic
1103954254 12:124567592-124567614 GGCGGCCGCGGCGGCGGTGGCGG + Intergenic
1111676813 13:91398663-91398685 GGCGGCGGCGGCGGCAGTGGCGG + Exonic
1121287605 14:92748497-92748519 GGCGACCGTGGTGGCAGTGGTGG + Exonic
1122137857 14:99645130-99645152 GGCGCTCGCGGCGGCAGGGAAGG - Exonic
1122558309 14:102593011-102593033 GGCGCCCGAGGCGGCAGTGGCGG - Exonic
1122776078 14:104117495-104117517 GGCGGGCGCGGCGACAGCGACGG + Intergenic
1122975375 14:105168683-105168705 GGCGACGGCGGCGGCGGTGAAGG + Exonic
1123684260 15:22786450-22786472 GCCGGACGCGGCGGCAGTGAGGG - Intronic
1125664165 15:41417148-41417170 GGCGGCGGCGGCGGCAGTGGCGG + Exonic
1132942269 16:2514147-2514169 GGCGGCCGAGGCGCCCATGACGG - Exonic
1135790489 16:25389781-25389803 GGTGAGCGCAGGGCCAGTGAAGG + Intergenic
1137926717 16:52547317-52547339 GGCGGCCGCGGCGGGGGTGATGG - Intronic
1138425986 16:56932326-56932348 GGCGACCGCGGCTGGAGTGTGGG + Exonic
1148615801 17:48998568-48998590 GGCGCGCGCGGTGGCAGTGAGGG + Intronic
1149997150 17:61411350-61411372 GGCGACCCCGGGGACAATGAGGG - Intergenic
1150217130 17:63477044-63477066 GGCGGCCGCGGCGCAGGAGAAGG + Intergenic
1151755331 17:76072439-76072461 GGCGGCGGCGGCGGCAGTGGCGG - Exonic
1153935221 18:9914590-9914612 GGCGGCGGCGGCGCCAGGGCCGG - Intronic
1154372307 18:13775191-13775213 GGCGACTGCAGCTCCAGTAAGGG - Intergenic
1155152780 18:23135815-23135837 GGCGCCCGCGGCGTCGGTGCCGG - Exonic
1160988001 19:1848410-1848432 GGCGACCGCGGCGCCAGTGAGGG - Exonic
1162696993 19:12484418-12484440 GGCGACTGCGGCCCCAGTCCCGG - Intronic
1166811663 19:45517988-45518010 GGCGAGCGTCGCGCCACTGATGG - Exonic
925177867 2:1797846-1797868 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177877 2:1797875-1797897 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177886 2:1797905-1797927 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177895 2:1797935-1797957 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177904 2:1797965-1797987 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177914 2:1797994-1798016 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177924 2:1798023-1798045 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177933 2:1798053-1798075 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177941 2:1798082-1798104 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177948 2:1798112-1798134 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177956 2:1798141-1798163 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177964 2:1798170-1798192 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177971 2:1798200-1798222 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925177979 2:1798229-1798251 GGAGACCGCCGCGCCTGTGCCGG - Intronic
925856644 2:8135254-8135276 GTAGACCGGCGCGCCAGTGAGGG - Intergenic
927504333 2:23603356-23603378 GGCTACAGCGGCGGCAGTCAGGG + Intronic
931392195 2:61853958-61853980 GGCGACCCGCGCTCCAGTGATGG + Exonic
934296790 2:91748923-91748945 GGCGGCGGCGGCGGCAGCGACGG - Intergenic
937044986 2:118846537-118846559 GGCGGCCGCGGCGGCAGTGGCGG - Exonic
945988378 2:216372298-216372320 GGCGGCCGCGGCGCCGGCGGCGG - Intergenic
948449637 2:238061060-238061082 GGCGGCCGTGGCGCCGGGGAGGG + Exonic
948920784 2:241064964-241064986 GGCGAGGGCGCCTCCAGTGAGGG + Intronic
1169065659 20:2693092-2693114 GGCGGCGGCGGCGACAGTGGCGG - Exonic
1172428574 20:34872689-34872711 GGCGCCCGCGGCCCCGCTGAGGG - Exonic
1174231191 20:49046650-49046672 GGCGACCCCAGGGCCTGTGAGGG + Intronic
1176194987 20:63832606-63832628 GGCGCCCGCGACGGCAGTAAGGG - Intergenic
1181312529 22:21952881-21952903 GGCGCCCGCGGCGCCCGCGGCGG - Intergenic
1181934615 22:26429594-26429616 GGCGGCGGCGGCGCCGGTAAGGG - Intronic
1184649395 22:45912734-45912756 GGGGACCCAGGGGCCAGTGAAGG + Intergenic
1203252494 22_KI270733v1_random:124758-124780 CGCGACCGCGGCGGCGGTGGTGG + Intergenic
954613641 3:51958822-51958844 GGAGACCGGAGAGCCAGTGATGG + Exonic
955239342 3:57165367-57165389 GGCGGCCGCGGCGGCAGCGAAGG + Exonic
955524097 3:59803326-59803348 GGCGAGCACGGGGCCAGCGAAGG + Intronic
961182369 3:124887013-124887035 AGCGACCGCGCCGCCGCTGAGGG - Exonic
964087546 3:152835603-152835625 GGCGAACGCGGGGCCAGAGCTGG + Exonic
964201225 3:154121393-154121415 GCCGACCGCGGCGCCGGCGCCGG - Intronic
965520462 3:169664395-169664417 GGCGACCGGGGCAGCAGTGGGGG - Intergenic
965551258 3:169967040-169967062 GGCGACGGCGGAGACAGAGACGG + Intronic
974386094 4:61202538-61202560 GGCGGCCGCGGCGCCGGGGCGGG + Intronic
975166895 4:71187291-71187313 GGCGGCCGCGGTGGCAGCGAAGG + Exonic
977810034 4:101347391-101347413 GGCGGCCGCGGCACCAGCGGCGG - Exonic
980053933 4:128062009-128062031 GGCGACGGCGGCGGCGGTGGCGG - Intronic
982198175 4:152936439-152936461 GGCGACCGCGGCGCGGGACACGG + Intronic
985629869 5:1008818-1008840 GGGGACAGCGGCGGCAGCGACGG - Exonic
988437529 5:31193802-31193824 GGCGACCGCGGCGGCGGCGGCGG + Exonic
997301976 5:132813310-132813332 GGCGAGCGCGGCGCGGGGGATGG + Intergenic
1006472730 6:34237530-34237552 GGCGCCCGCGGCGCGGGGGAAGG - Intronic
1017497569 6:154995323-154995345 GGCGGCCGCGGCCACAGTTACGG - Intronic
1018774353 6:166999418-166999440 GGCGACGGCGGCCGCAGTGGTGG + Exonic
1018910560 6:168098847-168098869 GGTGACCGTGGCTGCAGTGATGG + Intergenic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1028540851 7:91940884-91940906 GGCGGCGGCGGCGGCGGTGACGG + Exonic
1034222979 7:149460116-149460138 GGCGGCCCCGGCTCCTGTGAGGG - Intronic
1034446895 7:151118373-151118395 GGCAGCCGCGGCCCCAGTGCTGG + Intronic
1044719752 8:95133992-95134014 GGCGGCGGCGGCGACAGCGAAGG - Exonic
1049555314 8:143278656-143278678 GGCGACCCCGGCGCCCGGGTTGG + Intergenic
1049621779 8:143601522-143601544 CACGGCCGCGGTGCCAGTGAGGG + Exonic
1049662158 8:143824342-143824364 GGCGGCGGCGGCGGCAGTGGTGG - Exonic
1051146211 9:14030219-14030241 GGCGGCGGCGGGGCCAGGGAGGG + Intergenic
1057810960 9:98256159-98256181 GCCGTCCGCGGCGTCACTGACGG - Intergenic
1057869780 9:98708910-98708932 GGCAGCGGCGGCGCCCGTGACGG + Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1187826180 X:23334762-23334784 GGCGCCCGCGGCGGCGGCGACGG - Exonic
1187915718 X:24150340-24150362 GGCGGCAGCGGCGCCGGTGACGG + Intronic
1188005408 X:25013167-25013189 TGCGGCCACGGCGCCAGTGGCGG + Exonic
1189821627 X:44874024-44874046 GGCGAGCGCGGCGCCGGCCAGGG - Intronic
1190474406 X:50813143-50813165 GGCGGCGGCGGCGGCAGTGGCGG + Intronic
1192657045 X:73003213-73003235 GGCGACAGCAGCGACAGTGGCGG + Intergenic
1192665075 X:73079788-73079810 GGCGACAGCAGCGACAGTGGCGG - Intergenic
1195803301 X:108735928-108735950 GGGGATCGCGGCGCCAGAGGCGG + Exonic