ID: 1160988479

View in Genome Browser
Species Human (GRCh38)
Location 19:1851083-1851105
Sequence CAGTGCAATCACCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160988479_1160988484 -1 Left 1160988479 19:1851083-1851105 CCAGGGCCAAGGTGATTGCACTG No data
Right 1160988484 19:1851105-1851127 GGTTCAGGTGAGTCGTGAGGAGG No data
1160988479_1160988485 13 Left 1160988479 19:1851083-1851105 CCAGGGCCAAGGTGATTGCACTG No data
Right 1160988485 19:1851119-1851141 GTGAGGAGGCTAGACCGTCGCGG No data
1160988479_1160988483 -4 Left 1160988479 19:1851083-1851105 CCAGGGCCAAGGTGATTGCACTG No data
Right 1160988483 19:1851102-1851124 ACTGGTTCAGGTGAGTCGTGAGG No data
1160988479_1160988486 16 Left 1160988479 19:1851083-1851105 CCAGGGCCAAGGTGATTGCACTG No data
Right 1160988486 19:1851122-1851144 AGGAGGCTAGACCGTCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160988479 Original CRISPR CAGTGCAATCACCTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr