ID: 1160991603

View in Genome Browser
Species Human (GRCh38)
Location 19:1862583-1862605
Sequence GAACCGCGTCGCCGCCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160991603_1160991612 14 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991612 19:1862620-1862642 CAGATAAGGAAACTGAGGCTGGG 0: 22
1: 159
2: 769
3: 1796
4: 3331
1160991603_1160991607 0 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991607 19:1862606-1862628 CTCCTCCATTTTCACAGATAAGG 0: 1
1: 0
2: 5
3: 38
4: 337
1160991603_1160991610 9 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991610 19:1862615-1862637 TTTCACAGATAAGGAAACTGAGG 0: 30
1: 546
2: 2992
3: 8918
4: 17127
1160991603_1160991618 22 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991618 19:1862628-1862650 GAAACTGAGGCTGGGGGAGGGGG 0: 1
1: 1
2: 59
3: 391
4: 2541
1160991603_1160991616 20 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991616 19:1862626-1862648 AGGAAACTGAGGCTGGGGGAGGG 0: 1
1: 20
2: 92
3: 698
4: 4463
1160991603_1160991617 21 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991617 19:1862627-1862649 GGAAACTGAGGCTGGGGGAGGGG 0: 1
1: 13
2: 72
3: 469
4: 2458
1160991603_1160991611 13 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991611 19:1862619-1862641 ACAGATAAGGAAACTGAGGCTGG 0: 4
1: 66
2: 229
3: 624
4: 1596
1160991603_1160991614 16 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991614 19:1862622-1862644 GATAAGGAAACTGAGGCTGGGGG 0: 1
1: 10
2: 116
3: 647
4: 2379
1160991603_1160991613 15 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991613 19:1862621-1862643 AGATAAGGAAACTGAGGCTGGGG 0: 1
1: 72
2: 392
3: 1529
4: 3559
1160991603_1160991615 19 Left 1160991603 19:1862583-1862605 CCCCGGCGGCGGCGACGCGGTTC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1160991615 19:1862625-1862647 AAGGAAACTGAGGCTGGGGGAGG 0: 1
1: 12
2: 140
3: 854
4: 3929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160991603 Original CRISPR GAACCGCGTCGCCGCCGCCG GGG (reversed) Intronic
900305288 1:2003792-2003814 AAACCACGCCGCCGGCGCCGCGG - Exonic
902470372 1:16644652-16644674 GAACCGGGTCGCGGCGGCCGAGG - Intergenic
903435106 1:23343826-23343848 GAGCCGCTTCGCTCCCGCCGCGG - Intronic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
905025354 1:34845841-34845863 GAAGCGGGCCGCTGCCGCCGGGG - Intronic
905126456 1:35718961-35718983 GAACCGCTTCGCCCCCGCGCGGG + Exonic
905174104 1:36125421-36125443 GACCCGCGGCTCGGCCGCCGGGG + Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
923007904 1:230067038-230067060 GACCCCCCTCGCCGCCTCCGAGG + Intronic
1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG + Exonic
1072654622 10:97321173-97321195 CACGCGCGTCGCCGCCACCGCGG + Exonic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1081872421 11:46389531-46389553 GGAGCGAGCCGCCGCCGCCGGGG + Intergenic
1083572789 11:63769054-63769076 GAAGCGCGTCGCAGCGGACGCGG - Intergenic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1098963679 12:76764145-76764167 GGCCCGCGTCGCCTCCGGCGGGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1108314094 13:49221008-49221030 GAACAGCGCCGCGGCCTCCGCGG - Exonic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1119310795 14:73644870-73644892 GGACTGCGTGGCGGCCGCCGGGG - Intronic
1122648014 14:103207687-103207709 GCACCGCGAAGCCGTCGCCGTGG - Intergenic
1122658611 14:103279421-103279443 GCACCGCGGAGCCGTCGCCGTGG - Intergenic
1128370032 15:67033748-67033770 AAACTGGGTCGCCTCCGCCGCGG - Intergenic
1131146990 15:90020475-90020497 GAACTGCCTCCCCGCCCCCGGGG + Intronic
1131195617 15:90352434-90352456 GCAGCGCGCCGCTGCCGCCGCGG - Intronic
1132055956 15:98650113-98650135 GCACCGCGTCTCCGCTGCTGGGG + Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1139364817 16:66427009-66427031 GCACCGCGGCGCCGCGGCCCGGG - Intergenic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1149685379 17:58531858-58531880 GACCCGCGGCACCGCAGCCGCGG - Intronic
1151526326 17:74671418-74671440 GTACCGCGCCGCGGCCGCTGCGG + Intronic
1152789916 17:82273378-82273400 GAATCGGGCCGCCGCCGCCATGG - Exonic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1157464309 18:47930830-47930852 GAGCTGCTTCTCCGCCGCCGCGG + Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1160516432 18:79481600-79481622 GAACCGCCTCGGCGCTGCCAAGG + Intronic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161038030 19:2096296-2096318 GCACCGCCTCGCAGCCGCCGCGG + Exonic
1163575867 19:18110456-18110478 GAAACGCACCGCCGCCTCCGGGG + Intronic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1165721494 19:38082435-38082457 CCACCGTGTCCCCGCCGCCGAGG - Exonic
1168336497 19:55600292-55600314 CCCCCGCCTCGCCGCCGCCGAGG + Intronic
926185925 2:10690524-10690546 GAACTGCCTCGCCCCCGCCCGGG - Intergenic
929501161 2:42493057-42493079 GAGCCGCCTCGGCCCCGCCGGGG + Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
941905729 2:170715463-170715485 GGAGCGGGACGCCGCCGCCGAGG - Exonic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
1175439650 20:58981553-58981575 GTCCCGCGGCGCGGCCGCCGGGG + Intronic
1176548990 21:8213478-8213500 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1176550033 21:8217047-8217069 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176556883 21:8257690-8257712 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1176567919 21:8396508-8396530 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1176568960 21:8400082-8400104 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176575823 21:8440727-8440749 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1176576874 21:8444317-8444339 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1185119076 22:48955035-48955057 GAACCGCGTGGTGGCCTCCGGGG + Intergenic
1203253874 22_KI270733v1_random:129785-129807 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1203254923 22_KI270733v1_random:133373-133395 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203261930 22_KI270733v1_random:174864-174886 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1203262979 22_KI270733v1_random:178452-178474 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
954299047 3:49689578-49689600 GAGCCGGGTCGCTGCGGCCGAGG + Exonic
955182319 3:56683415-56683437 GGACCTCGACGCCGCAGCCGTGG + Intergenic
961377308 3:126475598-126475620 GCACGGCGGCGCTGCCGCCGAGG - Exonic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
976226161 4:82797394-82797416 GAACCACTTCGCAGCCGCCCTGG - Intronic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
995342257 5:111073033-111073055 GCTCCGGGACGCCGCCGCCGGGG + Intronic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG + Intronic
1001381981 5:171311324-171311346 GCACCGCGGGGCCGCCGGCGGGG - Intronic
1002401659 5:178994566-178994588 CCACCTCGTCGCCGTCGCCGCGG + Exonic
1002526766 5:179819547-179819569 GAGCCACGTGGCCCCCGCCGAGG - Intronic
1003623868 6:7726152-7726174 GAATTCCGGCGCCGCCGCCGCGG + Intergenic
1006271123 6:32968476-32968498 GAACCGCATCTCCGGCGGCGGGG - Intronic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1019308571 7:347865-347887 GAACCCCGTCCCCGCGGCCTGGG - Intergenic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1037879535 8:22566080-22566102 GACCGGGGTCGCGGCCGCCGGGG + Intronic
1041280947 8:56211081-56211103 TAAACGCCTCGCCGCCGCCCCGG + Intronic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1049936320 9:504609-504631 GAACCGCACGGCCGCCGCCGGGG - Intronic
1054842665 9:69760045-69760067 AGGCCGCGTCCCCGCCGCCGCGG + Intergenic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1203470274 Un_GL000220v1:112929-112951 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1203471325 Un_GL000220v1:116519-116541 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203478095 Un_GL000220v1:156901-156923 GAACCCCGGCGCCGCGGCCACGG - Intergenic
1203479146 Un_GL000220v1:160491-160513 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1189385818 X:40536132-40536154 GAACCACTGCGCCCCCGCCGGGG + Intergenic
1190008063 X:46758967-46758989 CTACCGGGGCGCCGCCGCCGCGG - Exonic