ID: 1160994351

View in Genome Browser
Species Human (GRCh38)
Location 19:1875808-1875830
Sequence GAGGGGCACGGCGCACGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160994344_1160994351 -4 Left 1160994344 19:1875789-1875811 CCGAAACGTGAGCCGCGCTGAGG 0: 1
1: 1
2: 0
3: 6
4: 70
Right 1160994351 19:1875808-1875830 GAGGGGCACGGCGCACGACCGGG 0: 1
1: 1
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160994351 Original CRISPR GAGGGGCACGGCGCACGACC GGG Intergenic