ID: 1160994386

View in Genome Browser
Species Human (GRCh38)
Location 19:1875975-1875997
Sequence TCGCAGCCCCGACCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160994382_1160994386 6 Left 1160994382 19:1875946-1875968 CCGCTTACCATGGAACGGCGGGC 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994375_1160994386 23 Left 1160994375 19:1875929-1875951 CCGAACGTCCCGTAGCACCGCTT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994378_1160994386 14 Left 1160994378 19:1875938-1875960 CCGTAGCACCGCTTACCATGGAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994377_1160994386 15 Left 1160994377 19:1875937-1875959 CCCGTAGCACCGCTTACCATGGA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994383_1160994386 -1 Left 1160994383 19:1875953-1875975 CCATGGAACGGCGGGCGCTGCCT 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994374_1160994386 27 Left 1160994374 19:1875925-1875947 CCTTCCGAACGTCCCGTAGCACC 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160994386 Original CRISPR TCGCAGCCCCGACCCCGCGG CGG Intergenic