ID: 1160994386

View in Genome Browser
Species Human (GRCh38)
Location 19:1875975-1875997
Sequence TCGCAGCCCCGACCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160994383_1160994386 -1 Left 1160994383 19:1875953-1875975 CCATGGAACGGCGGGCGCTGCCT 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994375_1160994386 23 Left 1160994375 19:1875929-1875951 CCGAACGTCCCGTAGCACCGCTT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994377_1160994386 15 Left 1160994377 19:1875937-1875959 CCCGTAGCACCGCTTACCATGGA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994374_1160994386 27 Left 1160994374 19:1875925-1875947 CCTTCCGAACGTCCCGTAGCACC 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994382_1160994386 6 Left 1160994382 19:1875946-1875968 CCGCTTACCATGGAACGGCGGGC 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131
1160994378_1160994386 14 Left 1160994378 19:1875938-1875960 CCGTAGCACCGCTTACCATGGAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG 0: 1
1: 0
2: 2
3: 4
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160994386 Original CRISPR TCGCAGCCCCGACCCCGCGG CGG Intergenic
900101566 1:964272-964294 CCGCAGCCCCGACTCCAGGGTGG - Intronic
900205015 1:1427937-1427959 CCGCAGCCCCGCCCCCGCCACGG + Intergenic
900944505 1:5822264-5822286 TCACAGCCCCCACCCTGGGGAGG + Intergenic
902801094 1:18830764-18830786 TAGCACCCCAGACCCCGCGGTGG + Intergenic
902818172 1:18927801-18927823 ACGCAGCCCTGACCCCACCGGGG - Intronic
903193488 1:21669160-21669182 TCGCAGCGAAGACCCCGCGCGGG - Intronic
905369217 1:37474456-37474478 AGGCAGCCCCGCCCCCGGGGCGG + Intergenic
905948097 1:41920388-41920410 TCGCAGCCCCTATTCCCCGGGGG - Intronic
912401461 1:109397441-109397463 CCGCAGCCCCGAAACTGCGGCGG - Intronic
920600684 1:207321422-207321444 TCGCAGGCCCCACCCAGCAGTGG + Intergenic
1065214998 10:23439915-23439937 CCGCAGCCCCGGTCCCGCCGCGG + Exonic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1070327619 10:75398901-75398923 GCGCAGCCCCCACCACGCGCTGG - Exonic
1071532697 10:86401441-86401463 CCGTGGGCCCGACCCCGCGGGGG + Intergenic
1071573886 10:86712117-86712139 TCGCAACCCCGACTCCGTCGGGG - Intronic
1076850162 10:133088630-133088652 TCGCAGCCCCGACCCCGCCAGGG - Intronic
1077358108 11:2127915-2127937 GAGCAGCCCCGACCCCCTGGGGG + Intergenic
1081545047 11:44065960-44065982 TGGCAGACCCGGCCCGGCGGCGG + Intronic
1083303262 11:61749818-61749840 TCTCAGCCCAGCCCCTGCGGGGG + Intergenic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1084412366 11:69012303-69012325 ACCCAGCCCCGACGCCGCTGGGG + Intronic
1085266811 11:75242176-75242198 TCAGAGCCCCGAGCCCGGGGAGG - Exonic
1089046112 11:115503565-115503587 TCCCCGGCCCGGCCCCGCGGGGG - Intronic
1091718222 12:2794910-2794932 TCCCAGCCCCTCCCTCGCGGCGG + Intergenic
1092537588 12:9403520-9403542 TCTCAGTCCCCACCTCGCGGGGG - Intergenic
1092557194 12:9570204-9570226 TCTCAGTCCCCACCTCGCGGGGG + Intergenic
1097925433 12:65121608-65121630 TCGCGGCCCCGCCCCCGGGGGGG - Intergenic
1100444826 12:94650593-94650615 CCGCCTCCCCCACCCCGCGGCGG - Intergenic
1104001640 12:124863978-124864000 TCCCCGCCCCGACCCCGCCCCGG - Intronic
1104891023 12:132140250-132140272 TGGCAGCACCGGCCCTGCGGGGG + Intronic
1106498783 13:30307470-30307492 TGGCAGCCGCGGCCGCGCGGTGG + Exonic
1107467870 13:40666044-40666066 TGCCAACCCCGACGCCGCGGCGG - Exonic
1114483201 14:23047938-23047960 CCGCTGCCCCCCCCCCGCGGTGG + Exonic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1118994181 14:70822041-70822063 CCGCAGCTCCGATCCCCCGGCGG - Intergenic
1125725418 15:41866009-41866031 TCTCAGCCCCCACCCAGCTGGGG + Intronic
1130908607 15:88256358-88256380 TCGCGGCTCCCACCCGGCGGCGG - Exonic
1132615567 16:839751-839773 TTGCAGCCCCGGCCACTCGGTGG - Intergenic
1132889540 16:2196905-2196927 TGGGAGCCCCGACGCGGCGGCGG + Intergenic
1133057038 16:3150481-3150503 TCACAGTCCCGGGCCCGCGGCGG + Intergenic
1133212681 16:4272166-4272188 TCCCCGCCCCCACCCCGCGCCGG + Intronic
1133325088 16:4937260-4937282 TCCAAGCCCCGCCCGCGCGGTGG - Intronic
1141490363 16:84368462-84368484 GCGCAGCCCCGCCCCAGGGGCGG + Intergenic
1141635800 16:85313223-85313245 TCGGAGCCCTGACCCCACGCAGG - Intergenic
1142227373 16:88884209-88884231 TCCCAGCCCCCACCTTGCGGAGG - Intronic
1142249355 16:88983983-88984005 TCGCAGCCCTCACCCCGCCTGGG - Intergenic
1142985865 17:3695175-3695197 TCAGAGCCCTGACCCCGGGGTGG - Intronic
1146371154 17:32266201-32266223 CCCCAGCCCGGGCCCCGCGGTGG + Exonic
1147166278 17:38595220-38595242 CCGCCGCCCCGACCCCGAGATGG + Intronic
1147612723 17:41811332-41811354 TCGCGGCCCCGAGCGCACGGCGG + Intronic
1148334460 17:46832268-46832290 TCGGAGCCCCCACCCCGGGCCGG + Intronic
1148648022 17:49230405-49230427 CCACAGCCCCCACCCCGCGCCGG + Intronic
1149772387 17:59331932-59331954 CCGCACCCCCAACCCCGCGCAGG - Intronic
1156379705 18:36547007-36547029 TCACAGCGCTGACCCCGCTGAGG + Intronic
1158190959 18:54828425-54828447 ACCCAGCCCCGCCGCCGCGGCGG + Exonic
1160024095 18:75204694-75204716 GCGCAGGCCCGGCGCCGCGGTGG + Intronic
1160682076 19:416539-416561 TCCCAGCCCCAGCCCCGCGAGGG + Intergenic
1160703303 19:518229-518251 TCCCAGCCCCTACCCAGCCGGGG - Intronic
1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG + Intergenic
1161299892 19:3537557-3537579 TCTCCGCCCAGACCCCGGGGAGG - Intronic
1161512383 19:4679004-4679026 CCGAAGCCCCGCCCCCGCTGAGG + Intronic
1163534504 19:17869395-17869417 CCGCAGCCTGGACCCCACGGTGG + Intergenic
1166105969 19:40598212-40598234 TCCCGGCCCCGCCCCCGCCGCGG - Intronic
1166736946 19:45091584-45091606 TCGCAGCGCCGGCTCCGCCGAGG + Intronic
1166873930 19:45886003-45886025 TCGGAGCCCGGACCGGGCGGGGG - Exonic
1167071715 19:47226091-47226113 TCGCAGCCCCGCCCCGCGGGAGG - Intronic
1167991714 19:53366126-53366148 TCGCAGCTCCGGTCCCGGGGAGG + Intronic
1168177222 19:54634248-54634270 TCCCAGACCCGATTCCGCGGGGG + Intronic
1168316995 19:55488817-55488839 CCCCAGCCCTGACCCTGCGGGGG + Intronic
1168346633 19:55653037-55653059 TCTCCGCCCTGGCCCCGCGGAGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925275227 2:2643810-2643832 TGCCAGCCCCGACCCGGCTGAGG + Intergenic
928511776 2:32010097-32010119 TCGGCGGCCCGGCCCCGCGGCGG - Intronic
935133484 2:100278738-100278760 TCCCAGCCACGACCTCGCCGTGG + Exonic
935618884 2:105111916-105111938 TCACAGCCCCTGCCCCGCCGAGG - Intergenic
937046808 2:118856048-118856070 CCGCACCCCCCACCCCCCGGAGG - Intergenic
938469236 2:131544226-131544248 TCGCCGCCCCCACCCCGCCACGG - Intergenic
940883391 2:158968790-158968812 CCGCAGCCCGGACTCCGCCGCGG + Intronic
946354595 2:219176963-219176985 TCGCAGCTCCCTCCCCCCGGCGG + Intronic
948874704 2:240820362-240820384 CCCCAGCCCCATCCCCGCGGCGG - Intergenic
948888677 2:240896551-240896573 TGGCTGCCCAGACCCCGCTGTGG + Intronic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1171483428 20:25469721-25469743 TCGCAGTCCCGACCATGCTGTGG + Intronic
1172870099 20:38130353-38130375 CTGCAGCCCAGACCCCGTGGAGG - Exonic
1175715729 20:61253160-61253182 TCTCACCCCCGAGCCCTCGGCGG + Intronic
1176448114 21:6839855-6839877 TCGCAGCCCGGACACTGGGGCGG - Intergenic
1176826284 21:13704877-13704899 TCGCAGCCCGGACACTGGGGCGG - Intergenic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1178429533 21:32506841-32506863 TCGCATCCCCGGCCCCACTGTGG + Intronic
1178488579 21:33033759-33033781 TCGCTTCCCCGACCCCGCACAGG + Intergenic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1179821328 21:43939058-43939080 TCGCAGCCCCGTCCCAGCCCTGG - Intronic
1181956359 22:26590135-26590157 CCGCGGCCCCGCCCCCGCGCGGG - Exonic
1183665731 22:39244717-39244739 TCGCAGCCCGCAGCCCGCAGAGG - Exonic
1184680647 22:46070902-46070924 CCGCAGCCCCGAGCGCGCCGCGG - Intronic
1185301584 22:50083844-50083866 TCGCAGCCCCTCCCCCGCCCAGG - Intronic
1185302486 22:50089833-50089855 TCGAAGCCCCGCCCACCCGGCGG + Intergenic
1185375537 22:50481334-50481356 ACGCAGCCCCGAGCCTGCGGGGG - Intergenic
949883627 3:8678984-8679006 TCTCAGTCCCCACCTCGCGGGGG - Intronic
949884360 3:8681803-8681825 TCTCAGTCCCCACCCTGCGGTGG - Intronic
957046706 3:75381222-75381244 TCGCATCCCCGGCCCCACTGTGG - Intergenic
961878771 3:130045290-130045312 TCGCATCCCCGGCCCCACTGTGG - Intergenic
962301921 3:134250729-134250751 TCACAGCCCCGAGCCGGGGGCGG + Exonic
964519062 3:157543648-157543670 TCTCTGCCCCCACCCCGCGCCGG - Intronic
968090371 3:195895345-195895367 CCGCAGCCCCCGCCCCGCAGCGG + Exonic
968317429 3:197736620-197736642 TCGCTGCCCCGACTCCGCGGCGG + Intronic
968434129 4:576254-576276 CCGCCGCCGCGACCCCGCGCCGG + Intergenic
968990999 4:3912338-3912360 TCGCATCCCCGGCCCCACTGTGG - Intergenic
969824345 4:9745197-9745219 TCGCATCCCCGGCCCCACTGTGG + Intergenic
971231019 4:24800245-24800267 GCGCGGCCCCCACCCGGCGGCGG + Exonic
985064304 4:186105472-186105494 GCGCGGCCCAGACCCCGCCGGGG - Intronic
996978537 5:129461622-129461644 TCCCGGCCCCGGCCCCACGGGGG + Exonic
1006458293 6:34144269-34144291 TCCCGGCCCCGCCCCCGCGCGGG + Intronic
1015984206 6:138869457-138869479 TCGCAGCCCCCACCCAGTGCAGG - Intronic
1017311466 6:152982455-152982477 TCGCAGCCCTGTCACCGCCGGGG + Intronic
1020313828 7:6890218-6890240 TCGCACCCCCGGCCCCACTGTGG - Intergenic
1022089103 7:27096309-27096331 TCCCAGCCCCCACCTCCCGGAGG - Intergenic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1027151819 7:75738839-75738861 GCCCAGCGCCGACCCCGCGCCGG + Exonic
1027191002 7:75995344-75995366 TCCCAGCCCCACCCACGCGGTGG + Intergenic
1029098420 7:98107291-98107313 CCGCAGCCCCGTCCCCGCCGCGG - Intronic
1032117038 7:129126422-129126444 TCGCAGCCCCGGGCTCGCGTAGG + Intergenic
1034303488 7:150034876-150034898 TCTCAGTCCCTACCTCGCGGGGG + Intergenic
1034462979 7:151208692-151208714 TCGCAGCCCCGGACCAGGGGAGG + Intronic
1034801631 7:154059203-154059225 TCTCAGTCCCTACCTCGCGGGGG - Intronic
1034801946 7:154060422-154060444 TCGCAGTCCCCGCCTCGCGGGGG - Intronic
1034802625 7:154062823-154062845 TCGCAGTCCCCGCCTCGCGGGGG - Intronic
1037961843 8:23103396-23103418 TGGCTGCCCCGAGCCCGCGAAGG + Intronic
1039886006 8:41654172-41654194 TCCCGGCCCCGCCCTCGCGGCGG - Intronic
1053372721 9:37576227-37576249 CCGCGGCCCGGACTCCGCGGTGG - Exonic
1059769792 9:117414659-117414681 TCCCAGCCCCGGCCCCGGCGCGG + Exonic
1060661673 9:125408405-125408427 TCGCAGCCGAGGCCCAGCGGTGG - Intergenic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062423983 9:136497654-136497676 TGCCTGCCCCCACCCCGCGGAGG - Intronic
1203521076 Un_GL000213v1:44663-44685 TCGCAGCCCGGACACTGGGGCGG + Intergenic
1196871902 X:120120555-120120577 TCGCAGCCCAGAGTCTGCGGAGG + Intergenic
1197753426 X:129980475-129980497 CCGCGGCCCCCACCCCGCGTGGG + Intergenic
1200092960 X:153644319-153644341 GCGCAGCGCCCACCCTGCGGCGG + Intronic