ID: 1160995364

View in Genome Browser
Species Human (GRCh38)
Location 19:1879835-1879857
Sequence GGGGGGCGGGCTTCCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 6, 1: 4, 2: 4, 3: 45, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995364_1160995377 2 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995377 19:1879860-1879882 CCCCCCGCCTGGTCCCCTCTTGG 0: 2
1: 6
2: 2
3: 16
4: 258
1160995364_1160995384 13 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995384 19:1879871-1879893 GTCCCCTCTTGGGTGTGCCCAGG 0: 6
1: 4
2: 2
3: 13
4: 151
1160995364_1160995388 29 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995364_1160995370 -9 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995370 19:1879849-1879871 CCGCCCCCCGGCCCCCCGCCTGG 0: 2
1: 4
2: 12
3: 155
4: 1214
1160995364_1160995390 30 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995364_1160995379 3 Left 1160995364 19:1879835-1879857 CCTCCCAGGGAAGCCCGCCCCCC 0: 6
1: 4
2: 4
3: 45
4: 344
Right 1160995379 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 7
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995364 Original CRISPR GGGGGGCGGGCTTCCCTGGG AGG (reversed) Intronic