ID: 1160995365

View in Genome Browser
Species Human (GRCh38)
Location 19:1879837-1879859
Sequence TCCCAGGGAAGCCCGCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 6, 1: 0, 2: 1, 3: 28, 4: 232}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995356_1160995365 2 Left 1160995356 19:1879812-1879834 CCTCCTGCAGGGCCGCCCACCTT 0: 3
1: 3
2: 1
3: 24
4: 227
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995351_1160995365 15 Left 1160995351 19:1879799-1879821 CCACTGTGGCTCCCCTCCTGCAG 0: 6
1: 5
2: 0
3: 42
4: 420
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995360_1160995365 -10 Left 1160995360 19:1879824-1879846 CCGCCCACCTTCCTCCCAGGGAA 0: 9
1: 4
2: 9
3: 79
4: 672
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995355_1160995365 3 Left 1160995355 19:1879811-1879833 CCCTCCTGCAGGGCCGCCCACCT 0: 3
1: 3
2: 1
3: 34
4: 283
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995350_1160995365 24 Left 1160995350 19:1879790-1879812 CCTGTGCATCCACTGTGGCTCCC 0: 5
1: 2
2: 1
3: 28
4: 271
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995354_1160995365 4 Left 1160995354 19:1879810-1879832 CCCCTCCTGCAGGGCCGCCCACC 0: 8
1: 3
2: 2
3: 35
4: 436
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995349_1160995365 25 Left 1160995349 19:1879789-1879811 CCCTGTGCATCCACTGTGGCTCC 0: 5
1: 1
2: 2
3: 25
4: 194
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232
1160995357_1160995365 -1 Left 1160995357 19:1879815-1879837 CCTGCAGGGCCGCCCACCTTCCT 0: 8
1: 3
2: 6
3: 40
4: 315
Right 1160995365 19:1879837-1879859 TCCCAGGGAAGCCCGCCCCCCGG 0: 6
1: 0
2: 1
3: 28
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995365 Original CRISPR TCCCAGGGAAGCCCGCCCCC CGG Intronic