ID: 1160995367

View in Genome Browser
Species Human (GRCh38)
Location 19:1879839-1879861
Sequence GGCCGGGGGGCGGGCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 6, 1: 1, 2: 1, 3: 38, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995367_1160995384 9 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995384 19:1879871-1879893 GTCCCCTCTTGGGTGTGCCCAGG 0: 6
1: 4
2: 2
3: 13
4: 151
1160995367_1160995379 -1 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995379 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 7
3: 13
4: 179
1160995367_1160995377 -2 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995377 19:1879860-1879882 CCCCCCGCCTGGTCCCCTCTTGG 0: 2
1: 6
2: 2
3: 16
4: 258
1160995367_1160995388 25 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995367_1160995390 26 Left 1160995367 19:1879839-1879861 CCAGGGAAGCCCGCCCCCCGGCC 0: 6
1: 1
2: 1
3: 38
4: 378
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995367 Original CRISPR GGCCGGGGGGCGGGCTTCCC TGG (reversed) Intronic