ID: 1160995368

View in Genome Browser
Species Human (GRCh38)
Location 19:1879848-1879870
Sequence CAGGCGGGGGGCCGGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1884
Summary {0: 2, 1: 2, 2: 16, 3: 205, 4: 1659}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160995368_1160995388 16 Left 1160995368 19:1879848-1879870 CCCGCCCCCCGGCCCCCCGCCTG 0: 2
1: 2
2: 16
3: 205
4: 1659
Right 1160995388 19:1879887-1879909 GCCCAGGCTGAGCTGCCCCCAGG 0: 7
1: 5
2: 11
3: 70
4: 491
1160995368_1160995390 17 Left 1160995368 19:1879848-1879870 CCCGCCCCCCGGCCCCCCGCCTG 0: 2
1: 2
2: 16
3: 205
4: 1659
Right 1160995390 19:1879888-1879910 CCCAGGCTGAGCTGCCCCCAGGG 0: 6
1: 1
2: 9
3: 60
4: 426
1160995368_1160995379 -10 Left 1160995368 19:1879848-1879870 CCCGCCCCCCGGCCCCCCGCCTG 0: 2
1: 2
2: 16
3: 205
4: 1659
Right 1160995379 19:1879861-1879883 CCCCCGCCTGGTCCCCTCTTGGG 0: 2
1: 2
2: 7
3: 13
4: 179
1160995368_1160995384 0 Left 1160995368 19:1879848-1879870 CCCGCCCCCCGGCCCCCCGCCTG 0: 2
1: 2
2: 16
3: 205
4: 1659
Right 1160995384 19:1879871-1879893 GTCCCCTCTTGGGTGTGCCCAGG 0: 6
1: 4
2: 2
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160995368 Original CRISPR CAGGCGGGGGGCCGGGGGGC GGG (reversed) Intronic